Mouse FLRT3 Gene ORF cDNA clone expression plasmid,N terminal Myc tag

Gene

Species

Mouse

NCBI Ref Seq

NM_178382.4

RefSeq ORF Size

1950bp

Gene Synonym

mKIAA1469, 5530600M07Rik, C430047I10Rik

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Mouse fibronectin leucine rich transmembrane protein 3 Gene ORF cDNA clone expression plasmid,N terminal Myc tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-N-Myc

Restriction Site

Protein Tag

Myc

Tag Sequence

GAGCAGAAACTCATCTCAGAAGAGGATCTG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Leucine-rich repeat transmembrane protein FLRT3, also known as Fibronectin-like domain-containing leucine-rich transmembrane protein 3, and FLRT3, is a single-pass type I membrane protein which belongs to the fibronectin leucine rich transmembrane protein (FLRT) family. FLRT3 contains one fibronectin type-III domain and ten LRR (leucine-rich) repeats and is expressed in kidney, brain, pancreas, skeletal muscle, lung, liver, placenta, and heart. It has a provocative expression pattern during somite development being expressed in regions of the somite where muscle precursor cells migrate from the dermomyotome and move into the myotome, and later in myotomal precursors destined to migrate towards their final destination. FLRT1, FLRT2 and FLRT3 are members of the FLRT family. The FLRT family of leucine-rich repeat (LRR) proteins is implicated in fibroblast growth factor (FGF) signalling, early embryonic development and neurite outgrowth. FLRT3 shares 55% amino acid sequence identity with FLRT1 and 44% identity with FLRT2. Two alternatively spliced transcript variants encoding the same protein have been described. The expression of FLRT3 is controlled by fibroblast growth factors (FGFs). FLRT3 has been implicated in neurite outgrowth after nerve damage, as a positive regulator of FGF signalling and in homotypic cell adhesion. FLRT3 may have a crucial role in regulating cellular adhesion between the epithelial apical ridge and the underlying mesenchyme and in establishing the dorso-ventral position of the ridge.

References

Smith TG, et al. (2006) The expression of Flrt3 during chick limb development. Int J Dev Biol. 50(8): 701-4.

Haines BP, et al. (2006) Regulated expression of FLRT genes implies a functional role in the regulation of FGF signalling during mouse development. Dev Biol. 297(1): 14-25.

Karaulanov EE, et al. (2006) A role for fibronectin-leucine-rich transmembrane cell-surface proteins in homotypic cell adhesion. EMBO Rep. 7(3): 283-90.

Gong SG, et al. (2009) Flrt2 and Flrt3 have overlapping and non-overlapping expression during craniofacial development. Gene Expr Patterns. 29(7): 497-502.

Catalog Number:HGC870-NM