Mouse FLRT3 Gene ORF cDNA clone expression plasmid,C terminal Flag tag

Gene

Species

Mouse

NCBI Ref Seq

NM_178382.4

RefSeq ORF Size

1950bp

Gene Synonym

mKIAA1469, 5530600M07Rik, C430047I10Rik

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Mouse fibronectin leucine rich transmembrane protein 3 Gene ORF cDNA clone expression plasmid,C terminal Flag tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-C-FLAG

Restriction Site

Protein Tag

Flag

Tag Sequence

GATTACAAGGATGACGACGATAAG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Leucine-rich repeat transmembrane protein FLRT3, also known as Fibronectin-like domain-containing leucine-rich transmembrane protein 3, and FLRT3, is a single-pass type I membrane protein which belongs to the fibronectin leucine rich transmembrane protein (FLRT) family. FLRT3 contains one fibronectin type-III domain and ten LRR (leucine-rich) repeats and is expressed in kidney, brain, pancreas, skeletal muscle, lung, liver, placenta, and heart. It has a provocative expression pattern during somite development being expressed in regions of the somite where muscle precursor cells migrate from the dermomyotome and move into the myotome, and later in myotomal precursors destined to migrate towards their final destination. FLRT1, FLRT2 and FLRT3 are members of the FLRT family. The FLRT family of leucine-rich repeat (LRR) proteins is implicated in fibroblast growth factor (FGF) signalling, early embryonic development and neurite outgrowth. FLRT3 shares 55% amino acid sequence identity with FLRT1 and 44% identity with FLRT2. Two alternatively spliced transcript variants encoding the same protein have been described. The expression of FLRT3 is controlled by fibroblast growth factors (FGFs). FLRT3 has been implicated in neurite outgrowth after nerve damage, as a positive regulator of FGF signalling and in homotypic cell adhesion. FLRT3 may have a crucial role in regulating cellular adhesion between the epithelial apical ridge and the underlying mesenchyme and in establishing the dorso-ventral position of the ridge.

References

Smith TG, et al. (2006) The expression of Flrt3 during chick limb development. Int J Dev Biol. 50(8): 701-4.

Haines BP, et al. (2006) Regulated expression of FLRT genes implies a functional role in the regulation of FGF signalling during mouse development. Dev Biol. 297(1): 14-25.

Karaulanov EE, et al. (2006) A role for fibronectin-leucine-rich transmembrane cell-surface proteins in homotypic cell adhesion. EMBO Rep. 7(3): 283-90.

Gong SG, et al. (2009) Flrt2 and Flrt3 have overlapping and non-overlapping expression during craniofacial development. Gene Expr Patterns. 29(7): 497-502.

Catalog Number:HGC870-CF