Human FKBP14 Gene ORF cDNA clone expression plasmid,N terminal OFP tag

Gene

Species

Human

NCBI Ref Seq

NM_017946.2

RefSeq ORF Size

636bp

Gene Synonym

FKBP22, FLJ20731, FKBP14

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Human FK506 binding protein 14, 22 kDa Gene ORF cDNA clone expression plasmid,N terminal OFP tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-N-OFPSpark

Restriction Site

Protein Tag

OFPSpark

Tag Sequence

GATAGCACTGAG……CACCTGTTCCAG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

OFPSpark Tag Information

OFPSpark is a red (orange) fluorescent protein (excitation/emission maxima are 549 and 566 nm, respectively) derived from DsRed. Possessing high photostability and pH stability, OFPSpark is more than twice brighter than mOrange2. Fast OFPSpark maturation makes it clearly detectable in mammalian cells as early as within 8 hrs after transfection. OFPSpark can be expressed and detected in a wide range of organisms. Mammalian cells transiently transfected with OFPSpark expression vectors produce bright fluorescence in 8 hrs after transfection. No cytotoxic effects or visible protein aggregation are observed. For its monomer structure, OFPSpark performs well in some fusions and protein labeling applications.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

FKBP14 belongs to the FK506-binding protein family. It contains 2 EF-hand domains and one PPIase FKBP-type domain. FKBP14 can be detected in the lumen of the endoplasmic reticulum where it is thought to accelerate the folding of proteins during protein synthesis. Truncation of the amino-terminus of FKBP14 significantly decreases peptidyl prolyl cis-trans isomerase activity, therefore implicating that the PPIase FKBP-type domain must be located at the N-terminus. Defects in FKBP14 can cause Ehlers-Danlos syndrome with progressive kyphoscoliosis, myopathy, and hearing loss. A syndrome with features of Ehlers-Danlos syndrome types VIA and VIB on the one hand, and the collagen VI-related congenital myopathies Ullrich congenital muscular dystrophy and Bethlem myopathy on the other hand.

References

Baker K, et al. (2003) The secreted protein discovery initiative (SPDI), a large-scale effort to identify novel human secreted and transmembrane proteins: a bioinformatics assessment. Genome Res. 13:2265-70.

Ota T, et al. (2004) Complete sequencing and characterization of 21,243 full-length human cDNAs. Nat Genet. 36:40-5.

The MGC Project Team. (2004) The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC). Genome Res. 14:2121-7.

Catalog Number:HGC852-NO