Human FKBP14 Gene ORF cDNA clone expression plasmid,C terminal Myc tag

Catalog Number:HGC852-CM

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
636bp
Gene Synonym
FKBP22, FLJ20731, FKBP14
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human FK506 binding protein 14, 22 kDa Gene ORF cDNA clone expression plasmid,C terminal Myc tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-Myc
Restriction Site
Protein Tag
Myc
Tag Sequence
GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
FKBP14 belongs to the FK506-binding protein family. It contains 2 EF-hand domains and one PPIase FKBP-type domain. FKBP14 can be detected in the lumen of the endoplasmic reticulum where it is thought to accelerate the folding of proteins during protein synthesis. Truncation of the amino-terminus of FKBP14 significantly decreases peptidyl prolyl cis-trans isomerase activity, therefore implicating that the PPIase FKBP-type domain must be located at the N-terminus. Defects in FKBP14 can cause Ehlers-Danlos syndrome with progressive kyphoscoliosis, myopathy, and hearing loss. A syndrome with features of Ehlers-Danlos syndrome types VIA and VIB on the one hand, and the collagen VI-related congenital myopathies Ullrich congenital muscular dystrophy and Bethlem myopathy on the other hand.
References
  • Baker K, et al. (2003) The secreted protein discovery initiative (SPDI), a large-scale effort to identify novel human secreted and transmembrane proteins: a bioinformatics assessment. Genome Res. 13:2265-70.
  • Ota T, et al. (2004) Complete sequencing and characterization of 21,243 full-length human cDNAs. Nat Genet. 36:40-5.
  • The MGC Project Team. (2004) The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC). Genome Res. 14:2121-7.
  • TOP