Human FGFR3/CD333 Gene ORF cDNA clone expression plasmid,C terminal HA tag

Catalog Number:HGC821-CY

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
2421bp
Gene Synonym
ACH, CEK2, JTK4, CD333, HSFGFR3EX
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human fibroblast growth factor receptor 3 Gene ORF cDNA clone expression plasmid,C terminal HA tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-HA
Restriction Site
Protein Tag
HA
Tag Sequence
TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
HA Tag Information

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
FGFR3, also known as CD333, is a member of the fibroblast growth factor receptor (FGFR) family, with its amino acid sequence being highly conserved between members and among divergent species. FGFR family members differ from one another in their ligand affinities and tissue distribution. FGFRs are transmembrane catalytic receptors that have intracellular tyrosine kinase activity. Mutations in FGFR genes are the cause of several human developmental disorders characterized by skeletal abnormalities such as achondroplasia, and upregulation of FGFR expression may lead to cell transformation and cancer. FGFR3, a full-length representative protein would consist of an extracellular region, composed of three immunoglobulin-like domains, a single hydrophobic membrane-spanning segment and a cytoplasmic tyrosine kinase domain. The extracellular portion of FGFR3 interacts with fibroblast growth factors, setting in motion a cascade of downstream signals, ultimately influencing mitogenesis and differentiation. FGFR3 binds acidic and basic fibroblast growth hormone and plays a role in bone development and maintenance. Mutations in FGFR3 gene lead to craniosynostosis and multiple types of skeletal dysplasia. Three alternatively spliced transcript variants that encode different protein isoforms have been described. CD333 is the receptor for acidic and basic fibroblast growth factors.
References
  • Keegan K, et al. (1991) Isolation of an additional member of the fibroblast growth factor receptor family, FGFR-3. Proc Natl Acad Sci. 88(4):1095-9.
  • Hafner C, et al. (2007) FGFR3 mutations in epidermal nevi and seborrheic keratoses: lessons from urothelium and skin. J Invest Dermatol. 127(7):1572-3.
  • Lamy A, et al. (2006) Molecular profiling of bladder tumors based on the detection of FGFR3 and TP53 mutations. J Urol. 176(6 Pt 1):2686-9.
  • Schweitzer DN, et al. (2001) Subtle radiographic findings of achondroplasia in patients with Crouzon syndrome with acanthosis nigricans due to an Ala391Glu substitution in FGFR3. Am J Med Genet. 98 (1):75-91.
  • TOP