Human FGFR3/CD333 Gene ORF cDNA clone expression plasmid,C terminal Flag tag

Gene

Species

Human

NCBI Ref Seq

NM_000142.4

RefSeq ORF Size

2421bp

Gene Synonym

ACH, CEK2, JTK4, CD333, HSFGFR3EX

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Human fibroblast growth factor receptor 3 Gene ORF cDNA clone expression plasmid,C terminal Flag tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-C-FLAG

Restriction Site

Protein Tag

Flag

Tag Sequence

GATTACAAGGATGACGACGATAAG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

FGFR3, also known as CD333, is a member of the fibroblast growth factor receptor (FGFR) family, with its amino acid sequence being highly conserved between members and among divergent species. FGFR family members differ from one another in their ligand affinities and tissue distribution. FGFRs are transmembrane catalytic receptors that have intracellular tyrosine kinase activity. Mutations in FGFR genes are the cause of several human developmental disorders characterized by skeletal abnormalities such as achondroplasia, and upregulation of FGFR expression may lead to cell transformation and cancer. FGFR3, a full-length representative protein would consist of an extracellular region, composed of three immunoglobulin-like domains, a single hydrophobic membrane-spanning segment and a cytoplasmic tyrosine kinase domain. The extracellular portion of FGFR3 interacts with fibroblast growth factors, setting in motion a cascade of downstream signals, ultimately influencing mitogenesis and differentiation. FGFR3 binds acidic and basic fibroblast growth hormone and plays a role in bone development and maintenance. Mutations in FGFR3 gene lead to craniosynostosis and multiple types of skeletal dysplasia. Three alternatively spliced transcript variants that encode different protein isoforms have been described. CD333 is the receptor for acidic and basic fibroblast growth factors.

References

Keegan K, et al. (1991) Isolation of an additional member of the fibroblast growth factor receptor family, FGFR-3. Proc Natl Acad Sci. 88(4):1095-9.

Hafner C, et al. (2007) FGFR3 mutations in epidermal nevi and seborrheic keratoses: lessons from urothelium and skin. J Invest Dermatol. 127(7):1572-3.

Lamy A, et al. (2006) Molecular profiling of bladder tumors based on the detection of FGFR3 and TP53 mutations. J Urol. 176(6 Pt 1):2686-9.

Schweitzer DN, et al. (2001) Subtle radiographic findings of achondroplasia in patients with Crouzon syndrome with acanthosis nigricans due to an Ala391Glu substitution in FGFR3. Am J Med Genet. 98 (1):75-91.

Catalog Number:HGC821-CF