Human FAM3B Gene ORF cDNA clone expression plasmid,N terminal HA tag

Gene

Species

Human

NCBI Ref Seq

NM_058186.3

RefSeq ORF Size

708bp

Gene Synonym

2-21, ORF9, PANDER, PRED44, C21orf11, C21orf76, FAM3B

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Human family with sequence similarity 3, member B Gene ORF cDNA clone expression plasmid,N terminal HA tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-N-HA

Restriction Site

Protein Tag

HA

Tag Sequence

TATCCTTACGACGTGCCTGACTACGCC

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

HA Tag Information

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Pancreatic derived factor, also known as FAM3B, is an islet-specific secreted cytokine specifically expressed at high levels in the islets of Langerhans of the endocrine pancreas. FAM3B protein is present in alpha- and beta- cells of pancreatic islets, insulin-secreting beta-TC3 cells, and glucagon-secreting alpha-TC cells. FAM3B causes apoptosis of beta-cells as assessed by electron microscopy, annexin Ⅴ fluorescent staining, and flow-cytometric terminal deoxynucleotidyl transferase-mediated dUTP nick-end labeling assay. FAM3B activated caspase-3 while not affect cytosolic Ca²⁺ levels or nitric oxide levels. Hense, FAM3B may have a role in the process of pancreatic?-cell apoptosis of primary islet and cell lines. FAM3B secretion is regulated by glucose and other insulin secretagogues. This islet-specific secreted cytokine is secreted from both pancreatic alpha- and beta- cells. Glucose stimulates FAM3B secretion dose dependently in beta- cell lines and primary islets but not in alpha-cells. It is likely cosecreted with insulin via the same regulatory mechanisms and structure and conformation is vital for FAM3B secretion.

References

Cao X, et al. (2003) Pancreatic-derived factor (FAM3B), a novel islet cytokine, induces apoptosis of insulin-secreting beta-cells. Diabetes. 52(9): 2296-303.

Yang J, et al. (2005) Mechanisms of glucose-induced secretion of pancreatic-derived factor (PANDER or FAM3B) in pancreatic beta-cells. Diabetes. 54(11): 3217-28.

Xu W, et al. (2005) Interferon-gamma-induced regulation of the pancreatic derived cytokine FAM3B in islets and insulin-secreting betaTC3 cells. Mol Cell Endocrinol. 240(1-2): 74-81.

Catalog Number:HGC691-NY