Human FAM3B Gene ORF cDNA clone expression plasmid,N terminal Flag tag

Catalog Number:HGC691-NF

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
708bp
Gene Synonym
2-21, ORF9, PANDER, PRED44, C21orf11, C21orf76, FAM3B
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human family with sequence similarity 3, member B Gene ORF cDNA clone expression plasmid,N terminal Flag tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-FLAG
Restriction Site
Protein Tag
Flag
Tag Sequence
GATTACAAGGATGACGACGATAAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Pancreatic derived factor, also known as FAM3B, is an islet-specific secreted cytokine specifically expressed at high levels in the islets of Langerhans of the endocrine pancreas. FAM3B protein is present in alpha- and beta- cells of pancreatic islets, insulin-secreting beta-TC3 cells, and glucagon-secreting alpha-TC cells. FAM3B causes apoptosis of beta-cells as assessed by electron microscopy, annexin Ⅴ fluorescent staining, and flow-cytometric terminal deoxynucleotidyl transferase-mediated dUTP nick-end labeling assay. FAM3B activated caspase-3 while not affect cytosolic Ca2+ levels or nitric oxide levels. Hense, FAM3B may have a role in the process of pancreatic?-cell apoptosis of primary islet and cell lines. FAM3B secretion is regulated by glucose and other insulin secretagogues. This islet-specific secreted cytokine is secreted from both pancreatic alpha- and beta- cells. Glucose stimulates FAM3B secretion dose dependently in beta- cell lines and primary islets but not in alpha-cells. It is likely cosecreted with insulin via the same regulatory mechanisms and structure and conformation is vital for FAM3B secretion.
References
  • Cao X, et al. (2003) Pancreatic-derived factor (FAM3B), a novel islet cytokine, induces apoptosis of insulin-secreting beta-cells. Diabetes. 52(9): 2296-303.
  • Yang J, et al. (2005) Mechanisms of glucose-induced secretion of pancreatic-derived factor (PANDER or FAM3B) in pancreatic beta-cells. Diabetes. 54(11): 3217-28.
  • Xu W, et al. (2005) Interferon-gamma-induced regulation of the pancreatic derived cytokine FAM3B in islets and insulin-secreting betaTC3 cells. Mol Cell Endocrinol. 240(1-2): 74-81.
  • TOP