Human ERP27 Gene ORF cDNA clone expression plasmid,N terminal OFP tag

Catalog Number:HGC587-NO

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
822bp
Gene Synonym
PDIA8, C12orf46, ERP27
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human endoplasmic reticulum protein 27 kDa Gene ORF cDNA clone expression plasmid,N terminal OFP tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-OFPSpark
Restriction Site
Protein Tag
OFPSpark
Tag Sequence
GATAGCACTGAG……CACCTGTTCCAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
OFPSpark Tag Information

OFPSpark is a red (orange) fluorescent protein (excitation/emission maxima are 549 and 566 nm, respectively) derived from DsRed. Possessing high photostability and pH stability, OFPSpark is more than twice brighter than mOrange2. Fast OFPSpark maturation makes it clearly detectable in mammalian cells as early as within 8 hrs after transfection. OFPSpark can be expressed and detected in a wide range of organisms. Mammalian cells transiently transfected with OFPSpark expression vectors produce bright fluorescence in 8 hrs after transfection. No cytotoxic effects or visible protein aggregation are observed. For its monomer structure, OFPSpark performs well in some fusions and protein labeling applications.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
ERP27 contains 1 thioredoxin domain and is a noncatalytic member of the protein disulfide isomerase family. Protein disulfide isomerases (PDIs) constitute a family of structurally related enzymes which catalyze disulfide bonds formation, reduction, or isomerization of newly synthesized proteins in the lumen of the endoplasmic reticulum (ER). They act also as chaperones, and are, therefore, part of a quality-control system for the correct folding of the proteins in the same subcellular compartment. PDI has been found to have moderate effects (25-fold) on the rate of oxidative folding of proteins in vitro. Recombinant Human Protein Disulfide Isomerase is involved in disulphide-bond formation and isomerization, as well as the reduction of disulphide bonds in proteins. Recombinant PDI has been found to have moderate effects (25-fold) on the rate of oxidative folding of proteins in vitro. ERP27 is a widely expressed protein which localizes to the ER and may act as a protease, protein disulfide isomerase, thiol-disulfide oxidase or phospholipase. ERP27 doesn't contain a CXXC active site motif indicating that it is a catalytically redox-inactive member of the protein disulfide isomerase family.
References
  • Lamesch P, et al. (2007) hORFeome v3.1: a resource of human open reading frames representing over 10,000 human genes. Genomics. 89(3):307-15.
  • Ota T, et al. (2004) Complete sequencing and characterization of 21,243 full-length human cDNAs. Nat Genet. 36(1):40-5.
  • Alanen HI, et al. (2006) ERp27, a new non-catalytic endoplasmic reticulum-located human protein disulfide isomerase family member, interacts with ERp57. J Biol Chem. 281(44):33727-38.
  • TOP