Human ERP27 Gene ORF cDNA clone expression plasmid,N terminal Myc tag

Gene

Species

Human

NCBI Ref Seq

BC030218

RefSeq ORF Size

822bp

Gene Synonym

PDIA8, C12orf46, ERP27

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Human endoplasmic reticulum protein 27 kDa Gene ORF cDNA clone expression plasmid,N terminal Myc tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-N-Myc

Restriction Site

Protein Tag

Myc

Tag Sequence

GAGCAGAAACTCATCTCAGAAGAGGATCTG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

ERP27 contains 1 thioredoxin domain and is a noncatalytic member of the protein disulfide isomerase family. Protein disulfide isomerases (PDIs) constitute a family of structurally related enzymes which catalyze disulfide bonds formation, reduction, or isomerization of newly synthesized proteins in the lumen of the endoplasmic reticulum (ER). They act also as chaperones, and are, therefore, part of a quality-control system for the correct folding of the proteins in the same subcellular compartment. PDI has been found to have moderate effects (25-fold) on the rate of oxidative folding of proteins in vitro. Recombinant Human Protein Disulfide Isomerase is involved in disulphide-bond formation and isomerization, as well as the reduction of disulphide bonds in proteins. Recombinant PDI has been found to have moderate effects (25-fold) on the rate of oxidative folding of proteins in vitro. ERP27 is a widely expressed protein which localizes to the ER and may act as a protease, protein disulfide isomerase, thiol-disulfide oxidase or phospholipase. ERP27 doesn't contain a CXXC active site motif indicating that it is a catalytically redox-inactive member of the protein disulfide isomerase family.

References

Lamesch P, et al. (2007) hORFeome v3.1: a resource of human open reading frames representing over 10,000 human genes. Genomics. 89(3):307-15.

Ota T, et al. (2004) Complete sequencing and characterization of 21,243 full-length human cDNAs. Nat Genet. 36(1):40-5.

Alanen HI, et al. (2006) ERp27, a new non-catalytic endoplasmic reticulum-located human protein disulfide isomerase family member, interacts with ERp57. J Biol Chem. 281(44):33727-38.

Catalog Number:HGC587-NM