Human ERH Gene ORF cDNA clone expression plasmid,N terminal HA tag

Catalog Number:HGC575-NY

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
315bp
Gene Synonym
DROER
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human enhancer of rudimentary homolog (Drosophila) Gene ORF cDNA clone expression plasmid,N terminal HA tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-HA
Restriction Site
Protein Tag
HA
Tag Sequence
TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
HA Tag Information

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
ERH(enhancer of rudimentary homolog) belongs to the E(R) family. It is expressed in all tissues examined. The monomeric structure of ERH comprises a single domain consisting of three α-helices and four β-strands, which is a novel fold. In the crystal structure, ERH assumes a dimeric structure, through interactions between the β-sheet regions. The formation of an ERH dimer is consistent with the results of analytical ultracentrifugation. ERH may have a role in the cell cycle. The Drosophila protein ERH is a small protein of 104 amino acids. It has been found to be an enhancer of the rudimentary gene, involved in pyrimidine biosynthesis. From an evolutionary point of view, ERH is highly conserved and has been found to exist in probably all multicellular eukaryotic organisms. ERH interacts with POLDIP3.
References
  • Wojcik E, et al. (1994) The secreted glycoprotein CREG enhances differentiation of NTERA-2 human embryonal carcinoma cells. Oncogene. 19(17):2120-8.
  • Wen SJ, et al. (2003) Screening the proteins that interact with calpain in a human heart cDNA library using a yeast two-hybrid system. Hypertens Res. 25(4):647-52.
  • Gelsthorpe M, et al. (1997) The putative cell cycle gene, enhancer of rudimentary, encodes a highly conserved protein found in plants and animals. Gene. 186(2):189-95.
  • TOP