Human ERH Gene ORF cDNA clone expression plasmid,C terminal Myc tag

Gene

Species

Human

NCBI Ref Seq

BC014301

RefSeq ORF Size

315bp

Gene Synonym

DROER

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Human enhancer of rudimentary homolog (Drosophila) Gene ORF cDNA clone expression plasmid,C terminal Myc tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-C-Myc

Restriction Site

Protein Tag

Myc

Tag Sequence

GAGCAGAAACTCATCTCAGAAGAGGATCTG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

ERH(enhancer of rudimentary homolog) belongs to the E(R) family. It is expressed in all tissues examined. The monomeric structure of ERH comprises a single domain consisting of three α-helices and four β-strands, which is a novel fold. In the crystal structure, ERH assumes a dimeric structure, through interactions between the β-sheet regions. The formation of an ERH dimer is consistent with the results of analytical ultracentrifugation. ERH may have a role in the cell cycle. The Drosophila protein ERH is a small protein of 104 amino acids. It has been found to be an enhancer of the rudimentary gene, involved in pyrimidine biosynthesis. From an evolutionary point of view, ERH is highly conserved and has been found to exist in probably all multicellular eukaryotic organisms. ERH interacts with POLDIP3.

References

Wojcik E, et al. (1994) The secreted glycoprotein CREG enhances differentiation of NTERA-2 human embryonal carcinoma cells. Oncogene. 19(17):2120-8.

Wen SJ, et al. (2003) Screening the proteins that interact with calpain in a human heart cDNA library using a yeast two-hybrid system. Hypertens Res. 25(4):647-52.

Gelsthorpe M, et al. (1997) The putative cell cycle gene, enhancer of rudimentary, encodes a highly conserved protein found in plants and animals. Gene. 186(2):189-95.

Catalog Number:HGC575-CM