Mouse EphA7/Eph Receptor A7 Gene ORF cDNA clone expression plasmid,without any tag

Catalog Number:HGC540-UT

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
2997bp
Gene Synonym
Ebk, Ehk3, Mdk1, Cek11, Hek11, Epha7
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse Eph receptor A7 Gene ORF cDNA clone expression plasmid,without any tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-untagged
Restriction Site
Protein Tag
Tag Sequence
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Ephrin type-A receptor 7, also known as EphA7, belongs to the ephrin receptor subfamily of the protein-tyrosine kinase family which 16 known receptors (14 found in mammals) are involved: EPHA1, EPHA2, EPHA3, EPHA4, EPHA5, EPHA6, EPHA7, EPHA8, EPHA9, EPHA10, EPHB1, EPHB2, EPHB3, EPHB4, EPHB5, EPHB6. The Eph family of receptor tyrosine kinases (comprising EphA and EphB receptors) has been implicated in synapse formation and the regulation of synaptic function and plasticity6. Eph receptor-mediated signaling, which is triggered by ephrins7, probably modifies the properties of synapses during synaptic activation and remodeling. Ephrin receptors are components of cell signalling pathways involved in animal growth and development, forming the largest sub-family of receptor tyrosine kinases (RTKs). Ligand-mediated activation of Ephs induce various important downstream effects and Eph receptors have been studied for their potential roles in the development of cancer. Down-regulation of EphA7 secondary to hypermethylation has been reported in colorectal cancer. The expression of EphA7 was reduced in all tested gastric cancer cell lines; however, there is marked variability in expression among gastric carcinoma specimens. EphA7 may have roles in the pathogenesis and development of gastric carcinomas.
References
  • Rashid T, et al. (2005) Opposing gradients of ephrin-As and EphA7 in the superior colliculus are essential for topographic mapping in the mammalian visual system. Neuron. 47(1): 57-69.
  • Wang J, et al. (2007) Differential expression of EphA7 receptor tyrosine kinase in gastric carcinoma. Hum Pathol. 38(11): 1649-56.
  • Rogers JH, et al. (1999) Distribution of the receptor EphA7 and its ligands in development of the mouse nervous system. Brain Res Mol Brain Res. 74(1-2): 225-30.
  • TOP