Mouse EphA7/Eph Receptor A7 Gene ORF cDNA clone expression plasmid,C terminal OFP tag

Gene

Species

Mouse

NCBI Ref Seq

NM_010141.3

RefSeq ORF Size

2997bp

Gene Synonym

Ebk, Ehk3, Mdk1, Cek11, Hek11, Epha7

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Mouse Eph receptor A7 Gene ORF cDNA clone expression plasmid,C terminal OFP tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-C-OFPSpark

Restriction Site

Protein Tag

OFPSpark

Tag Sequence

GATAGCACTGAG……CACCTGTTCCAG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

OFPSpark Tag Information

OFPSpark is a red (orange) fluorescent protein (excitation/emission maxima are 549 and 566 nm, respectively) derived from DsRed. Possessing high photostability and pH stability, OFPSpark is more than twice brighter than mOrange2. Fast OFPSpark maturation makes it clearly detectable in mammalian cells as early as within 8 hrs after transfection. OFPSpark can be expressed and detected in a wide range of organisms. Mammalian cells transiently transfected with OFPSpark expression vectors produce bright fluorescence in 8 hrs after transfection. No cytotoxic effects or visible protein aggregation are observed. For its monomer structure, OFPSpark performs well in some fusions and protein labeling applications.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Ephrin type-A receptor 7, also known as EphA7, belongs to the ephrin receptor subfamily of the protein-tyrosine kinase family which 16 known receptors (14 found in mammals) are involved: EPHA1, EPHA2, EPHA3, EPHA4, EPHA5, EPHA6, EPHA7, EPHA8, EPHA9, EPHA10, EPHB1, EPHB2, EPHB3, EPHB4, EPHB5, EPHB6. The Eph family of receptor tyrosine kinases (comprising EphA and EphB receptors) has been implicated in synapse formation and the regulation of synaptic function and plasticity6. Eph receptor-mediated signaling, which is triggered by ephrins7, probably modifies the properties of synapses during synaptic activation and remodeling. Ephrin receptors are components of cell signalling pathways involved in animal growth and development, forming the largest sub-family of receptor tyrosine kinases (RTKs). Ligand-mediated activation of Ephs induce various important downstream effects and Eph receptors have been studied for their potential roles in the development of cancer. Down-regulation of EphA7 secondary to hypermethylation has been reported in colorectal cancer. The expression of EphA7 was reduced in all tested gastric cancer cell lines; however, there is marked variability in expression among gastric carcinoma specimens. EphA7 may have roles in the pathogenesis and development of gastric carcinomas.

References

Rashid T, et al. (2005) Opposing gradients of ephrin-As and EphA7 in the superior colliculus are essential for topographic mapping in the mammalian visual system. Neuron. 47(1): 57-69.

Wang J, et al. (2007) Differential expression of EphA7 receptor tyrosine kinase in gastric carcinoma. Hum Pathol. 38(11): 1649-56.

Rogers JH, et al. (1999) Distribution of the receptor EphA7 and its ligands in development of the mouse nervous system. Brain Res Mol Brain Res. 74(1-2): 225-30.

Catalog Number:HGC540-CO