Human Cyclin A1/CCNA1 Gene ORF cDNA clone expression plasmid,N terminal Flag tag

Catalog Number:HGB967-NF

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1398bp
Gene Synonym
CCNA1
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human cyclin A1 Gene ORF cDNA clone expression plasmid,N terminal Flag tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-FLAG
Restriction Site
Protein Tag
Flag
Tag Sequence
GATTACAAGGATGACGACGATAAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Cyclin A1 is a member of the highly conserved cyclin family that is characterized by a dramatic periodicity in protein abundance, and belongs to the A-type cyclin subfamily. The mammalian A-type cyclin family consists of two members: cyclin A1 and cyclin A2. Different cyclins exhibit distinct expression. Cyclin A1 is expressed in mice exclusively in the germ cell lineage and high rate of cyclinA1 is found in human testis and certain myeloid leukaemia cells. Cyclin A1 is primarily function in the control of meiosis. It serves as regulator subunits binding to cyclin-dependent kinase 1 (Cdk1) and cyclin-dependent kinase 2 (Cdk2), which give two different kinase activities, one appearing in S phase, the other in G2. Through this, cyclin A1 operate the entry and progression in cell cycle. High frequency of cyclin A1 overexpression has been observed in acute myelocytic leukemias, especially those that are at the promyelocyte and myeloblast stages of development.
References
  • Yang R, et al. (1999) Functions of Cyclin A1 in the cell cycle and its interactions with transcription factor E2F-1 and the Rb family of proteins. Molecular and Cellular biology. 19 (3): 2400-7.
  • Yang R, et al. (1999) Cyclin A1 expression in leukemia and normal hematopoietic cells. Blood. 93 (6): 2067-74.
  • TOP