Human Cyclin A1/CCNA1 Gene ORF cDNA clone expression plasmid,C terminal HA tag

Gene

Species

Human

NCBI Ref Seq

NM_003914.3

RefSeq ORF Size

1398bp

Gene Synonym

CCNA1

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Human cyclin A1 Gene ORF cDNA clone expression plasmid,C terminal HA tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-C-HA

Restriction Site

Protein Tag

HA

Tag Sequence

TATCCTTACGACGTGCCTGACTACGCC

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

HA Tag Information

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Cyclin A1 is a member of the highly conserved cyclin family that is characterized by a dramatic periodicity in protein abundance, and belongs to the A-type cyclin subfamily. The mammalian A-type cyclin family consists of two members: cyclin A1 and cyclin A2. Different cyclins exhibit distinct expression. Cyclin A1 is expressed in mice exclusively in the germ cell lineage and high rate of cyclinA1 is found in human testis and certain myeloid leukaemia cells. Cyclin A1 is primarily function in the control of meiosis. It serves as regulator subunits binding to cyclin-dependent kinase 1 (Cdk1) and cyclin-dependent kinase 2 (Cdk2), which give two different kinase activities, one appearing in S phase, the other in G2. Through this, cyclin A1 operate the entry and progression in cell cycle. High frequency of cyclin A1 overexpression has been observed in acute myelocytic leukemias, especially those that are at the promyelocyte and myeloblast stages of development.

References

Yang R, et al. (1999) Functions of Cyclin A1 in the cell cycle and its interactions with transcription factor E2F-1 and the Rb family of proteins. Molecular and Cellular biology. 19 (3): 2400-7.

Yang R, et al. (1999) Cyclin A1 expression in leukemia and normal hematopoietic cells. Blood. 93 (6): 2067-74.

Catalog Number:HGB967-CY