Cynomolgus CTRL-1 / Chymotrypsin-like protease Gene ORF cDNA clone expression plasmid,C terminal Myc tag

Catalog Number:HGB911-CM

Gene
Species
Cynomolgus
NCBI Ref Seq
RefSeq ORF Size
795bp
Gene Synonym
CTRL
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Cynomolgus chymotrypsin-like Gene ORF cDNA clone expression plasmid,C terminal Myc tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-Myc
Restriction Site
Protein Tag
Myc
Tag Sequence
GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
CTRL-1, also known as chymotrypsin-like protease, belongs to the peptidase S1 family. CTRL-1 contains 1 peptidase S1 domain. Its expression is increased in preeclampsia (PE). Placental-derived chymotrypsin-like protease is responsible for inducing endothelial inflammatory phenotypic changes possibly by upregulation of cell adhesion molecule expressions, activation of cellular protease, and induction of extracellular regulated kinase phosphorylation. Activated microglia have been observed in various neurodegenerative diseases, including Alzheimer's disease (AD), Parkinson's disease (PD), amyotrophic lateral sclerosis, and multiple sclerosis. Five structurally distinct inhibitors that are known to inhibit chymotrypsin-like proteases were partially protective. They might represent a novel class of drugs with benefit in diseases where overactivity of microglia contributes to the pathogenesis.
References
  • Yang Gu. et al., 2009, Reprod Sci. 16 (9): 905-13.
  • Klegeris A. et al., 2005, Glia. 51 (1):56-64.
  • Caroline V. Bamford. et al., 2007, nfect Immun. 75 (9): 4364-72.
  • TOP