Cynomolgus CTRL-1 / Chymotrypsin-like protease Gene ORF cDNA clone expression plasmid,C terminal Flag tag

Catalog Number:HGB911-CF

Gene
Species
Cynomolgus
NCBI Ref Seq
RefSeq ORF Size
795bp
Gene Synonym
CTRL
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Cynomolgus chymotrypsin-like Gene ORF cDNA clone expression plasmid,C terminal Flag tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-FLAG
Restriction Site
Protein Tag
Flag
Tag Sequence
GATTACAAGGATGACGACGATAAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
CTRL-1, also known as chymotrypsin-like protease, belongs to the peptidase S1 family. CTRL-1 contains 1 peptidase S1 domain. Its expression is increased in preeclampsia (PE). Placental-derived chymotrypsin-like protease is responsible for inducing endothelial inflammatory phenotypic changes possibly by upregulation of cell adhesion molecule expressions, activation of cellular protease, and induction of extracellular regulated kinase phosphorylation. Activated microglia have been observed in various neurodegenerative diseases, including Alzheimer's disease (AD), Parkinson's disease (PD), amyotrophic lateral sclerosis, and multiple sclerosis. Five structurally distinct inhibitors that are known to inhibit chymotrypsin-like proteases were partially protective. They might represent a novel class of drugs with benefit in diseases where overactivity of microglia contributes to the pathogenesis.
References
  • Yang Gu. et al., 2009, Reprod Sci. 16 (9): 905-13.
  • Klegeris A. et al., 2005, Glia. 51 (1):56-64.
  • Caroline V. Bamford. et al., 2007, nfect Immun. 75 (9): 4364-72.
  • TOP