Human CTAG2 Gene ORF cDNA clone expression plasmid,N terminal Myc tag

Catalog Number:HGB891-NM

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
543bp
Gene Synonym
CT2, ESO2, CAMEL, CT6.2, CT6.2a, CT6.2b, LAGE-1, LAGE2B
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human cancer/testis antigen 2 Gene ORF cDNA clone expression plasmid,N terminal Myc tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-Myc
Restriction Site
Protein Tag
Myc
Tag Sequence
GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
CAMEL (109 aa) is a tumor-specific protein translated from the LAGE-1 gene in an alternative open reading frame (ORF) starting at a second ATG start codon located 40 bp downstream of the first ATG start site. LAGE-1 shows 94% homology to tumor Ag NY-ESO-1 and both genes are located on chromosome Xp28. The LAGE-1 and NY-ESO-1 genes are frequently coexpressed in a wide variety of tumors, like melanoma, breast carcinoma, prostate and bladder cancers, but silent in normal tissues except for testis.
References
  • Slager E H, van der Minne C E, Krüse M, et al. Identification of multiple HLA-DR-restricted epitopes of the tumor-associated antigen CAMEL by CD4+ Th1/Th2 lymphocytes[J]. The Journal of Immunology, 2004, 172(8): 5095-5102.
  • TOP