Human CTAG2 Gene ORF cDNA clone expression plasmid,C terminal Flag tag

Catalog Number:HGB891-CF

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
543bp
Gene Synonym
CT2, ESO2, CAMEL, CT6.2, CT6.2a, CT6.2b, LAGE-1, LAGE2B
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human cancer/testis antigen 2 Gene ORF cDNA clone expression plasmid,C terminal Flag tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-FLAG
Restriction Site
Protein Tag
Flag
Tag Sequence
GATTACAAGGATGACGACGATAAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
CAMEL (109 aa) is a tumor-specific protein translated from the LAGE-1 gene in an alternative open reading frame (ORF) starting at a second ATG start codon located 40 bp downstream of the first ATG start site. LAGE-1 shows 94% homology to tumor Ag NY-ESO-1 and both genes are located on chromosome Xp28. The LAGE-1 and NY-ESO-1 genes are frequently coexpressed in a wide variety of tumors, like melanoma, breast carcinoma, prostate and bladder cancers, but silent in normal tissues except for testis.
References
  • Slager E H, van der Minne C E, Krüse M, et al. Identification of multiple HLA-DR-restricted epitopes of the tumor-associated antigen CAMEL by CD4+ Th1/Th2 lymphocytes[J]. The Journal of Immunology, 2004, 172(8): 5095-5102.
  • TOP