Human CPLX3 / Complexin 3 Gene ORF cDNA clone expression plasmid,N terminal HA tag

Catalog Number:HGB808-NY

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
477bp
Gene Synonym
CPXIII, CPX-III, Nbla11589
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human complexin 3 Gene ORF cDNA clone expression plasmid,N terminal HA tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-HA
Restriction Site
Protein Tag
HA
Tag Sequence
TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
HA Tag Information

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
CPLX3, also known as complexin 3, belongs to the complexin/synaphin family. As a SNARE-binding protein, complexin (CPX), can act either as a facilitator or as an inhibitor of membrane fusion, constituting a controversial dilemma. CPX acts sequentially on assembling SNAREpins, first facilitating zippering by nearly doubling the distance at which v- and t-SNAREs can engage and then clamping them into a half-zippered fusion-incompetent state. Specifically, the central helix of CPX allows SNAREs to form this intermediate energetic state at 9-15 nm but not when the bilayers are closer than 9 nm. Stabilizing the activated-clamped state at separations of less than 9 nm requires the accessory helix of CPX, which prevents membrane-proximal assembly of SNAREpins. CPLX3 binds to the SNARE core complex containing SNAP25, VAMP2 and STX1A.
References
  • Newton-Cheh C. et al., 2009, Nat Genet. 41(6): 666-76.
  • Li F. et al., 2011, Nat Struct Mol Biol. 18 (8): 941-6.
  • Amin N. et al., 2012, Mol Psychiatry. 17 (11): 1116-29.
  • TOP