Human CPLX3 / Complexin 3 Gene ORF cDNA clone expression plasmid,C terminal Myc tag

Catalog Number:HGB808-CM

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
477bp
Gene Synonym
CPXIII, CPX-III, Nbla11589
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human complexin 3 Gene ORF cDNA clone expression plasmid,C terminal Myc tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-Myc
Restriction Site
Protein Tag
Myc
Tag Sequence
GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
CPLX3, also known as complexin 3, belongs to the complexin/synaphin family. As a SNARE-binding protein, complexin (CPX), can act either as a facilitator or as an inhibitor of membrane fusion, constituting a controversial dilemma. CPX acts sequentially on assembling SNAREpins, first facilitating zippering by nearly doubling the distance at which v- and t-SNAREs can engage and then clamping them into a half-zippered fusion-incompetent state. Specifically, the central helix of CPX allows SNAREs to form this intermediate energetic state at 9-15 nm but not when the bilayers are closer than 9 nm. Stabilizing the activated-clamped state at separations of less than 9 nm requires the accessory helix of CPX, which prevents membrane-proximal assembly of SNAREpins. CPLX3 binds to the SNARE core complex containing SNAP25, VAMP2 and STX1A.
References
  • Newton-Cheh C. et al., 2009, Nat Genet. 41(6): 666-76.
  • Li F. et al., 2011, Nat Struct Mol Biol. 18 (8): 941-6.
  • Amin N. et al., 2012, Mol Psychiatry. 17 (11): 1116-29.
  • TOP