Human Contactin 4/CNTN4 transcript variant 1 Gene ORF cDNA clone expression plasmid,N terminal Flag tag

Gene

Species

Human

NCBI Ref Seq

NM_175607.1

RefSeq ORF Size

3081bp

Gene Synonym

CNTN4, AXCAM, BIG-2, SCA16, CNTN4A, MGC33615

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Human contactin 4, transcript variant 1 Gene ORF cDNA clone expression plasmid,N terminal Flag tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-N-FLAG

Restriction Site

Protein Tag

Flag

Tag Sequence

GATTACAAGGATGACGACGATAAG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Contactin-4, abbreviated as CNTN4, is a brain-derived protein belonging to the immunoglobulin superfamily. It has been found high expression in testes, thyroid, small intestine, uterus and brain. This protein is an neuronal membrane protein that functions as an glycosylphosphatidylinositol- anchored cell adhesion molecule. Contactin-4 is considered as a candidate protein responsible for the differentiation potential of human neuroblastoma cells and it has been implicated in some cases of autism and spinocerebellar ataxia type 16. Studies of the cantactin family have revealed a complex pattern of hemophilic and heterophilic interactions that are required for axon growth and pathfinding. Such studies demonstrate that these essential functions are mediated by the combination and juxtaposition of multiple Ig and FNIII domains. Second, these neuronal adhesion molecules demonstrate highly regulated temporal and spatial expression patterns in the CNS. For this reason, the disruption of the regulatory region of the predominant brain-expressed isoform reasonable would be expected to have significant functional consequences.

References

Zeng L, et al. (2002) A novel splice variant of the cell adhesion molecule contactin 4 ( CNTN4) is mainly expressed in human brain. J Hum Genet. 47 (9): 497-9.

Thomas Fernandez, et al. (2004) Disruption of Contactin 4 (CNTN4) Results in Developmental Delay and Other Features of 3p Deletion Syndrome. Am J Hum Genet. 74 (6): 1286-93.

Yoshihara Y, et al. (1996) Overlapping and differential expression of BIG-2, BIG-1, TAG-1, and F3: four members of an axon-associated cell adhesion molecule subgroup of the immunoglobulin superfamily. J Neurobiol. 28 (1): 51-69.

Catalog Number:HGB765-NF