Human Contactin 4/CNTN4 transcript variant 1 Gene ORF cDNA clone expression plasmid,C terminal Myc tag

Catalog Number:HGB765-CM

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
3081bp
Gene Synonym
CNTN4, AXCAM, BIG-2, SCA16, CNTN4A, MGC33615
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human contactin 4, transcript variant 1 Gene ORF cDNA clone expression plasmid,C terminal Myc tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-Myc
Restriction Site
Protein Tag
Myc
Tag Sequence
GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Contactin-4, abbreviated as CNTN4, is a brain-derived protein belonging to the immunoglobulin superfamily. It has been found high expression in testes, thyroid, small intestine, uterus and brain. This protein is an neuronal membrane protein that functions as an glycosylphosphatidylinositol- anchored cell adhesion molecule. Contactin-4 is considered as a candidate protein responsible for the differentiation potential of human neuroblastoma cells and it has been implicated in some cases of autism and spinocerebellar ataxia type 16. Studies of the cantactin family have revealed a complex pattern of hemophilic and heterophilic interactions that are required for axon growth and pathfinding. Such studies demonstrate that these essential functions are mediated by the combination and juxtaposition of multiple Ig and FNIII domains. Second, these neuronal adhesion molecules demonstrate highly regulated temporal and spatial expression patterns in the CNS. For this reason, the disruption of the regulatory region of the predominant brain-expressed isoform reasonable would be expected to have significant functional consequences. 
References
  • Zeng L, et al. (2002) A novel splice variant of the cell adhesion molecule contactin 4 ( CNTN4) is mainly expressed in human brain. J Hum Genet. 47 (9): 497-9.
  • Thomas Fernandez, et al. (2004) Disruption of Contactin 4 (CNTN4) Results in Developmental Delay and Other Features of 3p Deletion Syndrome. Am J Hum Genet. 74 (6): 1286-93.
  • Yoshihara Y, et al. (1996) Overlapping and differential expression of BIG-2, BIG-1, TAG-1, and F3: four members of an axon-associated cell adhesion molecule subgroup of the immunoglobulin superfamily. J Neurobiol. 28 (1): 51-69.
  • TOP