Human Coagulation Factor XI/F11 Gene ORF cDNA clone expression plasmid,C terminal Flag tag

Gene

Species

Human

NCBI Ref Seq

NM_000128.3

RefSeq ORF Size

1878bp

Gene Synonym

FXI, MGC141891

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Human coagulation factor XI Gene ORF cDNA clone expression plasmid,C terminal Flag tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-C-FLAG

Restriction Site

Protein Tag

Flag

Tag Sequence

GATTACAAGGATGACGACGATAAG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Factor XI (plasma thromboplastin antecedent) is a plasma glycoprotein, and a zymogen acting as a serine protease which participates in blood coagulation as a catalyst in the conversion of factor IX to factor IXa in the presence of calcium ions. It is an unusual dimeric protease, with structural features that distinguish it from vitamin K-dependent coagulation proteases. The factor XI is synthesized in the liver as a single polypeptide chain with a molecular weight estimated between 125 ~160 kDa and then is processed into a disulfide-bond linked homodimer. FXI is a homodimer, with each subunit containing four apple domains and a protease domain. The apple domains form a disk structure with binding sites for platelets, high molecular weight kininogen, and the substrate factor IX (FIX). FXI is converted to the active protease FXIa by cleavage of the Arg369-Ile370 bond on each subunit. After the activation reaction, Factor XIa is composed of two heavy and two light chains held together by three disulfide bonds. The heavy chains are derived from the amino termini of the zymogen and responsible for the binding of factor XI to high molecular weight kininogen and for the activation of factor IX, while the light chain contains the catalytic portion of the enzyme and is homologous to the trypsin family of serine proteases. FXI deficiency is a disorder characterized by a mild or no bleeding tendency. Severe FXI deficiency is an injury-related bleeding disorder common in Ashkenazi Jews and rare worldwide.

References

Gailani D, et al. (2009) Structural and functional features of factor XI. J Thromb Haemost. 7 Suppl 1: 75-8.

Duga S, et al. (2009) Factor XI Deficiency. Semin Thromb Hemost. 35(4): 416-25.

Emsley J, et al. (2010) Structure and function of factor XI. Blood. 115(13): 2569-77.

Catalog Number:HGB724-CF