Mouse CLIC4 Gene ORF cDNA clone expression plasmid,C terminal Myc tag

Gene

Species

Mouse

NCBI Ref Seq

NM_013885.2

RefSeq ORF Size

762bp

Gene Synonym

TU-74; mc3s5; D0Jmb3; mtCLIC

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Mouse chloride intracellular channel 4 (mitochondrial) Gene ORF cDNA clone expression plasmid,C terminal Myc tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-C-Myc

Restriction Site

Protein Tag

Myc

Tag Sequence

GAGCAGAAACTCATCTCAGAAGAGGATCTG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Chloride intracellular channel protein 4, also known as Intracellular chloride ion channel protein p64H1 and CLIC4, is a member of the chloride channel CLIC family. It contains one GST C-terminal domain. CLIC4 is a member of a family of intracellular chloride channels. It is regulated by p53, c-Myc, and tumor necrosis factor-alpha. CLIC4 is detected in epithelial cells from colon, esophagus and kidney (at protein level). CLIC4 has alternate cellular functions like a potential role in angiogenesis or in maintaining apical-basolateral membrane polarity during mitosis and cytokinesis. CLIC4 could promote endothelial cell proliferation and regulate endothelial morphogenesis (tubulogenesis). Expression of CLIC4 is prominent in heart, kidney, placenta and skeletal muscle. Overexpression of CLIC4 in cancer cells inhibits tumor growth. Conversely, overexpression of CLIC4 in tumor stromal cells stimulates tumor growth. Thus, CLIC4 participates in normal and pathological processes and may serve as a useful target for therapies in disturbances of homeostasis and neoplastic transformation. Loss of CLIC4 in tumor cells and gain in tumor stroma is common to many human cancers and marks malignant progression. Up-regulation of CLIC4 in tumor stroma is coincident with myofibroblast conversion, generally a poor prognostic indicator. Reactivation and restoration of CLIC4 in tumor cells or the converse in tumor stromal cells could provide a novel approach to inhibit tumor growth.

References

Ronnov-Jessen L., et al., 2002, Am. J. Pathol. 161:471-480.

Berryman M.A., et al., 2003, Cell Motil. Cytoskeleton 56:159-172.

Suh,K.S. et al., 2005, J Investig Dermatol Symp Proc. 10 (2):105-9.

Suh,K.S. et al., 2007, Mol Carcinog.46 (8):599-604.

Suh,K.S. et al., 2007, J Cell Sci 120 (Pt 15):2631-40.

Suh,K.S. et al., 2007, Clin Cancer Res 13 (1):121-31.

Catalog Number:HGB654-CM