Mouse CLIC4 Gene ORF cDNA clone expression plasmid,C terminal His tag

Gene

Species

Mouse

NCBI Ref Seq

NM_013885.2

RefSeq ORF Size

762bp

Gene Synonym

TU-74; mc3s5; D0Jmb3; mtCLIC

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Mouse chloride intracellular channel 4 (mitochondrial) Gene ORF cDNA clone expression plasmid,C terminal His tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-C-His

Restriction Site

Protein Tag

His

Tag Sequence

CACCATCACCACCATCATCACCACCATCAC

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

His Tag Information

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Chloride intracellular channel protein 4, also known as Intracellular chloride ion channel protein p64H1 and CLIC4, is a member of the chloride channel CLIC family. It contains one GST C-terminal domain. CLIC4 is a member of a family of intracellular chloride channels. It is regulated by p53, c-Myc, and tumor necrosis factor-alpha. CLIC4 is detected in epithelial cells from colon, esophagus and kidney (at protein level). CLIC4 has alternate cellular functions like a potential role in angiogenesis or in maintaining apical-basolateral membrane polarity during mitosis and cytokinesis. CLIC4 could promote endothelial cell proliferation and regulate endothelial morphogenesis (tubulogenesis). Expression of CLIC4 is prominent in heart, kidney, placenta and skeletal muscle. Overexpression of CLIC4 in cancer cells inhibits tumor growth. Conversely, overexpression of CLIC4 in tumor stromal cells stimulates tumor growth. Thus, CLIC4 participates in normal and pathological processes and may serve as a useful target for therapies in disturbances of homeostasis and neoplastic transformation. Loss of CLIC4 in tumor cells and gain in tumor stroma is common to many human cancers and marks malignant progression. Up-regulation of CLIC4 in tumor stroma is coincident with myofibroblast conversion, generally a poor prognostic indicator. Reactivation and restoration of CLIC4 in tumor cells or the converse in tumor stromal cells could provide a novel approach to inhibit tumor growth.

References

Ronnov-Jessen L., et al., 2002, Am. J. Pathol. 161:471-480.

Berryman M.A., et al., 2003, Cell Motil. Cytoskeleton 56:159-172.

Suh,K.S. et al., 2005, J Investig Dermatol Symp Proc. 10 (2):105-9.

Suh,K.S. et al., 2007, Mol Carcinog.46 (8):599-604.

Suh,K.S. et al., 2007, J Cell Sci 120 (Pt 15):2631-40.

Suh,K.S. et al., 2007, Clin Cancer Res 13 (1):121-31.

Catalog Number:HGB654-CH