Mouse CDNF/ARMETL1 Gene ORF cDNA clone expression plasmid,N terminal His tag

Catalog Number:HGB471-NH

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
564bp
Gene Synonym
CDNF, MGC129430, 9330140G23, Armetl1
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse arginine-rich, mutated in early stage tumors-like 1 Gene ORF cDNA clone expression plasmid,N terminal His tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-His
Restriction Site
Protein Tag
His
Tag Sequence
CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
His Tag Information

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Cerebral Dopamine Neurotrophic Factor (CDNF), also known as ARMETL1 (ARMET-like protein 1), is a secreted protein with eight conserved cysteine residues, predicting a unique protein fold and defining a new, evolutionarily conserved protein family. CDNF is a novel neurotrophic factor with strong trophic activity on dopaminergic neurons comparable to that of glial cell line-derived neurotrophic factor (GDNF). CDNF/ARMETL1 is a evolutionary conserved protein which can protect and restore the function of dopaminergic neurons in the rat model of Parkinson's disease, suggesting that CDNF might be beneficial for the treatment of Parkinson's disease. CDNF is widely expressed in neurons in several brain regions including cerebral cortex, hippocampus, substantia nigra, striatum and cerebellum. Human CDNF is glycosylated and secreted from transiently transfected cells. CDNF promotes the survival, growth, and function of dopamine-specific neurons and is expressed in brain regions that undergo cocaine-induced neuroplasticity.
References
  • Choi JM, et al. (2011) Analysis of mutations and the association between polymorphisms in the cerebral dopamine neurotrophic factor (CDNF) gene and Parkinson disease. Neurosci Lett. 493(3): 97-101.
  • Sun ZP, et al. (2011) Intracellular trafficking and secretion of cerebral dopamine neurotrophic factor in neurosecretory cells. J Neurochem. 117(1): 121-32.
  • Lohoff FW, et al. (2009) Association analysis between polymorphisms in the conserved dopamine neurotrophic factor (CDNF) gene and cocaine dependence. Neurosci Lett. 453(3): 199-203.
  • Lindholm P, et al. (2007) Novel neurotrophic factor CDNF protects and rescues midbrain dopamine neurons in vivo. Nature. 448(7149): 73-7.
  • TOP