Mouse CDNF/ARMETL1 Gene ORF cDNA clone expression plasmid,N terminal GFP tag

Gene

Species

Mouse

NCBI Ref Seq

NM_177647.4

RefSeq ORF Size

564bp

Gene Synonym

CDNF, MGC129430, 9330140G23, Armetl1

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Mouse arginine-rich, mutated in early stage tumors-like 1 Gene ORF cDNA clone expression plasmid,N terminal GFP tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-N-GFPSpark

Restriction Site

Protein Tag

GFPSpark

Tag Sequence

GTGAGCAAGGGC……GAGCTGTACAAG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

GFPSpark Tag Information

GFPSpark is an improved variant of the green fluorescent protein GFP. It possesses bright green fluorescence (excitation/ emission max = 487 / 508 nm) that is visible earlier than fluorescence of other green fluorescent proteins. GFPSpark is mainly intended for applications where fast appearance of bright fluorescence is crucial. It is specially recommended for cell and organelle labeling and tracking the promoter activity.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Cerebral Dopamine Neurotrophic Factor (CDNF), also known as ARMETL1 (ARMET-like protein 1), is a secreted protein with eight conserved cysteine residues, predicting a unique protein fold and defining a new, evolutionarily conserved protein family. CDNF is a novel neurotrophic factor with strong trophic activity on dopaminergic neurons comparable to that of glial cell line-derived neurotrophic factor (GDNF). CDNF/ARMETL1 is a evolutionary conserved protein which can protect and restore the function of dopaminergic neurons in the rat model of Parkinson's disease, suggesting that CDNF might be beneficial for the treatment of Parkinson's disease. CDNF is widely expressed in neurons in several brain regions including cerebral cortex, hippocampus, substantia nigra, striatum and cerebellum. Human CDNF is glycosylated and secreted from transiently transfected cells. CDNF promotes the survival, growth, and function of dopamine-specific neurons and is expressed in brain regions that undergo cocaine-induced neuroplasticity.

References

Choi JM, et al. (2011) Analysis of mutations and the association between polymorphisms in the cerebral dopamine neurotrophic factor (CDNF) gene and Parkinson disease. Neurosci Lett. 493(3): 97-101.

Sun ZP, et al. (2011) Intracellular trafficking and secretion of cerebral dopamine neurotrophic factor in neurosecretory cells. J Neurochem. 117(1): 121-32.

Lohoff FW, et al. (2009) Association analysis between polymorphisms in the conserved dopamine neurotrophic factor (CDNF) gene and cocaine dependence. Neurosci Lett. 453(3): 199-203.

Lindholm P, et al. (2007) Novel neurotrophic factor CDNF protects and rescues midbrain dopamine neurons in vivo. Nature. 448(7149): 73-7.

Catalog Number:HGB471-NG