Human CD46 Gene ORF cDNA clone expression plasmid,N terminal OFP tag

Gene

Species

Human

NCBI Ref Seq

BC030594

RefSeq ORF Size

1155bp

Gene Synonym

MCP, TLX, AHUS2, MIC10, TRA2.10, CD46

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Human CD46 molecule, complement regulatory protein Gene ORF cDNA clone expression plasmid,N terminal OFP tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-N-OFPSpark

Restriction Site

Protein Tag

OFPSpark

Tag Sequence

GATAGCACTGAG……CACCTGTTCCAG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

OFPSpark Tag Information

OFPSpark is a red (orange) fluorescent protein (excitation/emission maxima are 549 and 566 nm, respectively) derived from DsRed. Possessing high photostability and pH stability, OFPSpark is more than twice brighter than mOrange2. Fast OFPSpark maturation makes it clearly detectable in mammalian cells as early as within 8 hrs after transfection. OFPSpark can be expressed and detected in a wide range of organisms. Mammalian cells transiently transfected with OFPSpark expression vectors produce bright fluorescence in 8 hrs after transfection. No cytotoxic effects or visible protein aggregation are observed. For its monomer structure, OFPSpark performs well in some fusions and protein labeling applications.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

CD46, also known as Membrane Cofactor Protein (MCP), is a complement regulatory protein. CD46 is a type 1 membrane protein that plays an important inhibitory role in the complement system. CD46 is expressed in white blood cells, platelets, epithelial cells, and fibroblasts. Human CD46 shares 50% amino acid sequence identity with mouse and rat CD46. The importance of CD46 to complement regulation is underscored by the observation that genetic loss of CD46 leads to development of atypical hemolytic-uremic syndrome (aHUS), a disease characterized by uncontrolled complement activation. CD46 is implicated in the development and/or progression of selected cancer types.

References

Lublin D.M., et al.,(1988), Molecular cloning and chromosomal localization of human membrane cofactor protein (MCP). Evidence for inclusion in the multigene family of complement-regulatory proteins. J. Exp. Med. 168:181-194.

Purcell D.F., et al., (1991), Alternatively spliced RNAs encode several isoforms of CD46 (MCP), a regulator of complement activation.Immunogenetics 33:335-344.

Post T.W., et al.,(1991), Membrane cofactor protein of the complement system: alternative splicing of serine/threonine/proline-rich exons and cytoplasmic tails produces multiple isoforms that correlate with protein phenotype.J. Exp. Med. 174:93-102.

Catalog Number:HGB357-NO