Human CD46 Gene ORF cDNA clone expression plasmid,N terminal Flag tag

Catalog Number:HGB357-NF

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1155bp
Gene Synonym
MCP, TLX, AHUS2, MIC10, TRA2.10, CD46
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human CD46 molecule, complement regulatory protein Gene ORF cDNA clone expression plasmid,N terminal Flag tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-FLAG
Restriction Site
Protein Tag
Flag
Tag Sequence
GATTACAAGGATGACGACGATAAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
CD46, also known as Membrane Cofactor Protein (MCP), is a complement regulatory protein. CD46 is a type 1 membrane protein that plays an important inhibitory role in the complement system. CD46 is expressed in white blood cells, platelets, epithelial cells, and fibroblasts. Human CD46 shares 50% amino acid sequence identity with mouse and rat CD46. The importance of CD46 to complement regulation is underscored by the observation that genetic loss of CD46 leads to development of atypical hemolytic-uremic syndrome (aHUS), a disease characterized by uncontrolled complement activation. CD46 is implicated in the development and/or progression of selected cancer types.
References
  • Lublin D.M., et al.,(1988), Molecular cloning and chromosomal localization of human membrane cofactor protein (MCP). Evidence for inclusion in the multigene family of complement-regulatory proteins. J. Exp. Med. 168:181-194.
  • Purcell D.F., et al., (1991), Alternatively spliced RNAs encode several isoforms of CD46 (MCP), a regulator of complement activation.Immunogenetics 33:335-344.
  • Post T.W., et al.,(1991), Membrane cofactor protein of the complement system: alternative splicing of serine/threonine/proline-rich exons and cytoplasmic tails produces multiple isoforms that correlate with protein phenotype.J. Exp. Med. 174:93-102.
  • TOP