Human CD200RLa Gene ORF cDNA clone expression plasmid,N terminal Flag tag

Catalog Number:HGB309-NF

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
816bp
Gene Synonym
CD200R2, CD200RLa, CD200R1L
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human CD200 receptor 1-like Gene ORF cDNA clone expression plasmid,N terminal Flag tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-FLAG
Restriction Site
Protein Tag
Flag
Tag Sequence
GATTACAAGGATGACGACGATAAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Cell surface glycoprotein CD200 receptor 2, also known as Cell surface glycoprotein CD200 receptor 1-like, Cell surface glycoprotein OX2 receptor 2, CD200 receptor-like 2, CD200Rla, CD200R1L and CD200R2, is a single-pass type I  membrane protein which belongs to the CD200R family. CD200R1L / CD200R2. It contains one Ig-like C2-type (immunoglobulin-like) domain and one Ig-like V-type (immunoglobulin-like) domain. CD200 is a transmembrane protein delivering immunoregulatory signals after engagement of CD200R. A family of CD200Rs exist ( CD200R1, CD200R2, CD200R3, CD200R4 ) with different tissue expression and functional activity. In the presence of anti-CD200R2 / CD200R3 monoclonal antibodies (mAbs), bone-marrow cells cultured in the presence of (interleukin [IL]-4+granulocyte-macrophage colony-stimulating factor) differentiate into dendritic cells (DCs), which induce CD4+CD25+ Treg. Interaction between the relatively ubiquitously expressed molecule CD200 and one of its receptors, CD200R1, resulted in direct suppression of alloreactivity, engagement of alternate receptors led instead to altered differentiation of dendritic cells (DCs) from marrow precursors, which could in turn foster development of Foxp3(+) regulatory T cells. Unlike anti-CD200R1, anti-CD200R2 both promotes development of DCs with capacity to induce Treg and directly augments thymocyte production of Treg.
References
TOP