Human CD200RLa Gene ORF cDNA clone expression plasmid,C terminal Myc tag

Gene

Species

Human

NCBI Ref Seq

NM_001008784.2

RefSeq ORF Size

816bp

Gene Synonym

CD200R2, CD200RLa, CD200R1L

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Human CD200 receptor 1-like Gene ORF cDNA clone expression plasmid,C terminal Myc tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-C-Myc

Restriction Site

Protein Tag

Myc

Tag Sequence

GAGCAGAAACTCATCTCAGAAGAGGATCTG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Cell surface glycoprotein CD200 receptor 2, also known as Cell surface glycoprotein CD200 receptor 1-like, Cell surface glycoprotein OX2 receptor 2, CD200 receptor-like 2, CD200Rla, CD200R1L and CD200R2, is a single-pass type I membrane protein which belongs to the CD200R family. CD200R1L / CD200R2. It contains one Ig-like C2-type (immunoglobulin-like) domain and one Ig-like V-type (immunoglobulin-like) domain. CD200 is a transmembrane protein delivering immunoregulatory signals after engagement of CD200R. A family of CD200Rs exist ( CD200R1, CD200R2, CD200R3, CD200R4 ) with different tissue expression and functional activity. In the presence of anti-CD200R2 / CD200R3 monoclonal antibodies (mAbs), bone-marrow cells cultured in the presence of (interleukin [IL]-4+granulocyte-macrophage colony-stimulating factor) differentiate into dendritic cells (DCs), which induce CD4+CD25+ Treg. Interaction between the relatively ubiquitously expressed molecule CD200 and one of its receptors, CD200R1, resulted in direct suppression of alloreactivity, engagement of alternate receptors led instead to altered differentiation of dendritic cells (DCs) from marrow precursors, which could in turn foster development of Foxp3(+) regulatory T cells. Unlike anti-CD200R1, anti-CD200R2 both promotes development of DCs with capacity to induce Treg and directly augments thymocyte production of Treg.

References

Catalog Number:HGB309-CM