Rat CD153/CD30L/TNFSF8 Gene ORF cDNA clone expression plasmid,C terminal HA tag

Gene

Species

Rat

NCBI Ref Seq

XM_001064723.2

RefSeq ORF Size

714bp

Gene Synonym

Tnfsf8

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Rat tumor necrosis factor (ligand) superfamily, member 8 Gene ORF cDNA clone expression plasmid,C terminal HA tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-C-HA

Restriction Site

Protein Tag

HA

Tag Sequence

TATCCTTACGACGTGCCTGACTACGCC

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

HA Tag Information

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

CD30 ligand (CD30L), also known as CD153 and TNFSF8, is a membrane-associated glycoprotein belonging to the TNF superfamily and TNFR superfamily, and is a specific ligand for CD30/TNFRSF8 originally described as a cell surface antigen and a marker for Hodgkin lymphoma and related hematologic malignancies. CD30L is a type-II membrane glycoprotein expressed on activated T cells, stimulated monocyte-macrophages, granulocytes, eosinophils, and some Burkitt-like lymphoma cell lines. CD30L is capable of transducing signals through CD30 on different CD30+ lymphoma cell lines, and mediates pleiotropic biologic effects including cell proliferation, activation, differentiation, as well as cell death by apoptosis. CD30-CD30 ligand interaction has been suggested to have a pathophysiologic role in malignant lymphomas, particularly Hodgkin disease, large cell anaplastic lymphomas and Burkitt lymphomas, and is also involved in activation and functioning of the T cell-dependent immune response. Thus, CD153 and its receptor CD30 are regarded as therapeutic targets in hematologic malignancies, autoimmune and inflammatory diseases.

References

Hargreaves PG, et al. (2002) Soluble CD30 binds to CD153 with high affinity and blocks transmembrane signaling by CD30. Eur J Immunol. 32(1): 163-73.

Blazar BR, et al. (2004) CD30/CD30 ligand (CD153) interaction regulates CD4+ T cell-mediated graft-versus-host disease. J Immunol. 173(5): 2933-41.

Oflazoglu E, et al. (2009) Targeting CD30/CD30L in oncology and autoimmune and inflammatory diseases. Adv Exp Med Biol. 647: 174-85.

Catalog Number:HGB277-CY