Rat CD153/CD30L/TNFSF8 Gene ORF cDNA clone expression plasmid,C terminal OFP tag

Catalog Number:HGB277-CO

Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
714bp
Gene Synonym
Tnfsf8
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Rat tumor necrosis factor (ligand) superfamily, member 8 Gene ORF cDNA clone expression plasmid,C terminal OFP tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-OFPSpark
Restriction Site
Protein Tag
OFPSpark
Tag Sequence
GATAGCACTGAG……CACCTGTTCCAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
OFPSpark Tag Information

OFPSpark is a red (orange) fluorescent protein (excitation/emission maxima are 549 and 566 nm, respectively) derived from DsRed. Possessing high photostability and pH stability, OFPSpark is more than twice brighter than mOrange2. Fast OFPSpark maturation makes it clearly detectable in mammalian cells as early as within 8 hrs after transfection. OFPSpark can be expressed and detected in a wide range of organisms. Mammalian cells transiently transfected with OFPSpark expression vectors produce bright fluorescence in 8 hrs after transfection. No cytotoxic effects or visible protein aggregation are observed. For its monomer structure, OFPSpark performs well in some fusions and protein labeling applications.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
CD30 ligand (CD30L), also known as CD153 and TNFSF8, is a membrane-associated glycoprotein belonging to the TNF superfamily and TNFR superfamily, and is a specific ligand for CD30/TNFRSF8 originally described as a cell surface antigen and a marker for Hodgkin lymphoma and related hematologic malignancies. CD30L is a type-II membrane glycoprotein expressed on activated T cells, stimulated monocyte-macrophages, granulocytes, eosinophils, and some Burkitt-like lymphoma cell lines. CD30L is capable of transducing signals through CD30 on different CD30+ lymphoma cell lines, and mediates pleiotropic biologic effects including cell proliferation, activation, differentiation, as well as cell death by apoptosis. CD30-CD30 ligand interaction has been suggested to have a pathophysiologic role in malignant lymphomas, particularly Hodgkin disease, large cell anaplastic lymphomas and Burkitt lymphomas, and is also involved in activation and functioning of the T cell-dependent immune response. Thus, CD153 and its receptor CD30 are regarded as therapeutic targets in hematologic malignancies, autoimmune and inflammatory diseases.
References
  • Hargreaves PG, et al. (2002) Soluble CD30 binds to CD153 with high affinity and blocks transmembrane signaling by CD30. Eur J Immunol. 32(1): 163-73.
  • Blazar BR, et al. (2004) CD30/CD30 ligand (CD153) interaction regulates CD4+ T cell-mediated graft-versus-host disease. J Immunol. 173(5): 2933-41.
  • Oflazoglu E, et al. (2009) Targeting CD30/CD30L in oncology and autoimmune and inflammatory diseases. Adv Exp Med Biol. 647: 174-85.
  • TOP