Human Carbonic Anhydrase VB Gene ORF cDNA clone expression plasmid,N terminal Myc tag

Gene

Species

Human

NCBI Ref Seq

BC028142

RefSeq ORF Size

954bp

Gene Synonym

CA-VB, CA5B

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Human carbonic anhydrase VB, mitochondrial Gene ORF cDNA clone expression plasmid,N terminal Myc tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-N-Myc

Restriction Site

Protein Tag

Myc

Tag Sequence

GAGCAGAAACTCATCTCAGAAGAGGATCTG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Carbonic anhydrase 5B, also known as carbonate dehydratase VB, carbonic anhydrase VB, CA-VB and CA5B, is a member of the alpha-carbonic anhydrase family. The strongest expression of CA5B / CA-VB is in heart, pancreas, kidney, placenta, lung, and skeletal muscle. It is not expressed in liver. Carbonic anhydrases (CAs) are a large family of zinc metalloenzymes first discovered in 1933 that catalyze the reversible hydration of carbon dioxide. CAs participate in a variety of biological processes, including respiration, calcification, acid-base balance, bone resorption, and the formation of aqueous humor, cerebrospinal fluid, saliva, and gastric acid. CAs show extensive diversity in tissue distribution and in their subcellular localization. CA5B / CA-VB is localized in the mitochondria and shows the highest sequence similarity to the other mitochondrial CA5A / CA-VA. CA5B / CA-VB has a wider tissue distribution than CA5A / CA-VA, which is restricted to the liver. The differences in tissue distribution suggest that the two mitochondrial carbonic anhydrases evolved to assume different physiologic roles. CA5A / CA-VA is activated by histamine, L-adrenaline, L- and D-histidine, and L- and D-phenylalanine. It is inhibited by coumarins, sulfonamide derivatives such as acetazolamide and Foscarnet (phosphonoformate trisodium salt). CA5B / CA-VB is inhibited by coumarins, sulfonamide derivatives such as acetazolamide (AZA), saccharin and Foscarnet (phosphonoformate trisodium salt).

References

Fujikawa-Adachi K, et al.,1999, J Biol Chem. 274 (30): 21228-33.

Liao, S.Y. et al., 2003, J. Med. Genet. 40:257 - 262.

Temperini C.et al., 2006, Chemistry 12: 7057-66.

Temperini C.et al., 2006, J. Med. Chem. 49: 3019-27.

Supuran, C. T. et al., 2008, Curr Pharm Des. 14 (7): 601-602.

Elleuche, S. et al., 2009, Curr Genet. 55 (2): 211-222.

Maresca, A.et al., 2009, J. Am. Chem. Soc. 131:3057-3062.

Catalog Number:HGB100-NM