Human Carbonic Anhydrase VB Gene ORF cDNA clone expression plasmid,N terminal Flag tag

Catalog Number:HGB100-NF

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
954bp
Gene Synonym
CA-VB, CA5B
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human carbonic anhydrase VB, mitochondrial Gene ORF cDNA clone expression plasmid,N terminal Flag tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-FLAG
Restriction Site
Protein Tag
Flag
Tag Sequence
GATTACAAGGATGACGACGATAAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Carbonic anhydrase 5B, also known as carbonate dehydratase VB, carbonic anhydrase VB, CA-VB and CA5B, is a member of the alpha-carbonic anhydrase family. The strongest expression of CA5B / CA-VB is in heart, pancreas, kidney, placenta, lung, and skeletal muscle. It is not expressed in liver. Carbonic anhydrases (CAs) are a large family of zinc metalloenzymes first discovered in 1933 that catalyze the reversible hydration of carbon dioxide. CAs participate in a variety of biological processes, including respiration, calcification, acid-base balance, bone resorption, and the formation of aqueous humor, cerebrospinal fluid, saliva, and gastric acid. CAs show extensive diversity in tissue distribution and in their subcellular localization. CA5B / CA-VB is localized in the mitochondria and shows the highest sequence similarity to the other mitochondrial CA5A / CA-VA. CA5B / CA-VB has a wider tissue distribution than CA5A / CA-VA, which is restricted to the liver. The differences in tissue distribution suggest that the two mitochondrial carbonic anhydrases evolved to assume different physiologic roles. CA5A / CA-VA is activated by histamine, L-adrenaline, L- and D-histidine, and L- and D-phenylalanine. It is inhibited by coumarins, sulfonamide derivatives such as acetazolamide and Foscarnet (phosphonoformate trisodium salt). CA5B / CA-VB is inhibited by coumarins, sulfonamide derivatives such as acetazolamide (AZA), saccharin and Foscarnet (phosphonoformate trisodium salt).
References
  • Fujikawa-Adachi K, et al.,1999, J Biol Chem. 274 (30): 21228-33.
  • Liao, S.Y. et al., 2003, J. Med. Genet. 40:257 - 262.
  • Temperini C.et al., 2006, Chemistry 12: 7057-66.
  • Temperini C.et al., 2006, J. Med. Chem. 49: 3019-27.
  • Supuran, C. T. et al., 2008, Curr Pharm Des. 14 (7): 601-602.
  • Elleuche, S. et al., 2009, Curr Genet. 55 (2): 211-222.
  • Maresca, A.et al., 2009, J. Am. Chem. Soc. 131:3057-3062.
  • TOP