Rat Calreticulin Gene ORF cDNA clone expression plasmid,C terminal HA tag

Catalog Number:HGB066-CY

Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
1251bp
Gene Synonym
Calr
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Rat calreticulin Gene ORF cDNA clone expression plasmid,C terminal HA tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-HA
Restriction Site
Protein Tag
HA
Tag Sequence
TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
HA Tag Information

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Calreticulin is a multifunctional protein. It acts as a main Ca(2+)-binding (storage) protein in the lumen of the endoplasmic reticulum. Calreticulin binds Ca2+ ions (a second messenger in signal transduction), rendering it inactive. The Ca2+ is bound with low affinity, but high capacity, and can be released on a signal. Located in storage compartments associated with the endoplasmic reticulum, calreticulin also binds to misfolded proteins and prevents them from being exported from the endoplasmic reticulum to the golgi apparatus. The amino terminus of calreticulin interacts with the DNA-binding domain of the glucocorticoid receptor and prevents the receptor from binding to its specific glucocorticoid response element. Calreticulin reduces the binding of androgen receptor to its hormone-responsive DNA element and inhibits androgen receptor and retinoic acid receptor transcriptional activities in vivo, as well as retinoic acid-induced neuronal differentiation. Therefore, calreticulin acts as a significant modulator of the regulation of gene transcription by nuclear hormone receptors.
References
  • Michalak M, et al. (2002) Calreticulin in cardiac development and pathology. Biochim Biophys Acta. 1600(1-2):32-7.
  • Chao MP, et al. (2010) Calreticulin is the dominant pro-phagocytic signal on multiple human cancers and is counterbalanced by CD47. Sci Transl Med. 2(63):63ra94.
  • Andrin, C, et al. (1998) Interaction between a Ca2+-binding protein calreticulin and perforin, a component of the cytotoxic T-cell granules. Biochemistry. 37(29):10386-94.
  • TOP