Rat Calreticulin Gene ORF cDNA clone expression plasmid,C terminal Flag tag

Catalog Number:HGB066-CF

Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
1251bp
Gene Synonym
Calr
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Rat calreticulin Gene ORF cDNA clone expression plasmid,C terminal Flag tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-FLAG
Restriction Site
Protein Tag
Flag
Tag Sequence
GATTACAAGGATGACGACGATAAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Calreticulin is a multifunctional protein. It acts as a main Ca(2+)-binding (storage) protein in the lumen of the endoplasmic reticulum. Calreticulin binds Ca2+ ions (a second messenger in signal transduction), rendering it inactive. The Ca2+ is bound with low affinity, but high capacity, and can be released on a signal. Located in storage compartments associated with the endoplasmic reticulum, calreticulin also binds to misfolded proteins and prevents them from being exported from the endoplasmic reticulum to the golgi apparatus. The amino terminus of calreticulin interacts with the DNA-binding domain of the glucocorticoid receptor and prevents the receptor from binding to its specific glucocorticoid response element. Calreticulin reduces the binding of androgen receptor to its hormone-responsive DNA element and inhibits androgen receptor and retinoic acid receptor transcriptional activities in vivo, as well as retinoic acid-induced neuronal differentiation. Therefore, calreticulin acts as a significant modulator of the regulation of gene transcription by nuclear hormone receptors.
References
  • Michalak M, et al. (2002) Calreticulin in cardiac development and pathology. Biochim Biophys Acta. 1600(1-2):32-7.
  • Chao MP, et al. (2010) Calreticulin is the dominant pro-phagocytic signal on multiple human cancers and is counterbalanced by CD47. Sci Transl Med. 2(63):63ra94.
  • Andrin, C, et al. (1998) Interaction between a Ca2+-binding protein calreticulin and perforin, a component of the cytotoxic T-cell granules. Biochemistry. 37(29):10386-94.
  • TOP