Human C20orf70 Gene ORF cDNA clone expression plasmid,N terminal OFP tag

Gene

Species

Human

NCBI Ref Seq

BC065726

RefSeq ORF Size

750bp

Gene Synonym

PSP, SPLUNC2, C20orf70, bA49G10.1

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Human BPI fold containing family A, member 2 Gene ORF cDNA clone expression plasmid,N terminal OFP tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-N-OFPSpark

Restriction Site

Protein Tag

OFPSpark

Tag Sequence

GATAGCACTGAG……CACCTGTTCCAG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

OFPSpark Tag Information

OFPSpark is a red (orange) fluorescent protein (excitation/emission maxima are 549 and 566 nm, respectively) derived from DsRed. Possessing high photostability and pH stability, OFPSpark is more than twice brighter than mOrange2. Fast OFPSpark maturation makes it clearly detectable in mammalian cells as early as within 8 hrs after transfection. OFPSpark can be expressed and detected in a wide range of organisms. Mammalian cells transiently transfected with OFPSpark expression vectors produce bright fluorescence in 8 hrs after transfection. No cytotoxic effects or visible protein aggregation are observed. For its monomer structure, OFPSpark performs well in some fusions and protein labeling applications.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

C20orf70 belongs to the BPI/LBP/Plunc superfamily, Plunc family. PLUNC family is comprised by mucosal secretory proteins that are predicted to be structurally similar to lipid-binding and host-defense proteins including bactericidal/permeability-increasing protein and lipopolysaccharide-binding protein. C20orf70 can be detected in submandibular gland. C20orf70 gene contains 9 distinct gt-ag introns. Transcription produces 6 different mRNAs, 4 alternatively spliced variants and 2 unspliced forms. There are 2 probable alternative promotors, 3 non overlapping alternative last exons and 4 validated alternative polyadenylation sites. The mRNAs appear to differ by truncation of the 3' end. 80 bp of this gene are antisense to spliced gene glopa, raising the possibility of regulated alternate expression. C20orf70 is expected to have molecular function (lipid binding) and to localize in extracellular region. It is a salivary protein of unknown function.

References

Lamesch P, et al. (2007) hORFeome v3.1: a resource of human open reading frames representing over 10,000 human genes. Genomics. 89(3):307-15.

Vargas PA, et al. (2008) Expression of PLUNC family members in benign and malignant salivary gland tumours. Oral Dis. 14(7):613-9.

Bingle L, et al. (2009) Characterisation and expression of SPLUNC2, the human orthologue of rodent parotid secretory protein. Histochem Cell Biol. 132(3):339-49.

Catalog Number:HGA982-NO