Human C20orf70 Gene ORF cDNA clone expression plasmid,N terminal Myc tag

Catalog Number:HGA982-NM

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
750bp
Gene Synonym
PSP, SPLUNC2, C20orf70, bA49G10.1
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human BPI fold containing family A, member 2 Gene ORF cDNA clone expression plasmid,N terminal Myc tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-Myc
Restriction Site
Protein Tag
Myc
Tag Sequence
GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
C20orf70 belongs to the BPI/LBP/Plunc superfamily, Plunc family. PLUNC family is comprised by mucosal secretory proteins that are predicted to be structurally similar to lipid-binding and host-defense proteins including bactericidal/permeability-increasing protein and lipopolysaccharide-binding protein. C20orf70 can be detected in submandibular gland. C20orf70 gene contains 9 distinct gt-ag introns. Transcription produces 6 different mRNAs, 4 alternatively spliced variants and 2 unspliced forms. There are 2 probable alternative promotors, 3 non overlapping alternative last exons and 4 validated alternative polyadenylation sites. The mRNAs appear to differ by truncation of the 3' end. 80 bp of this gene are antisense to spliced gene glopa, raising the possibility of regulated alternate expression. C20orf70 is expected to have molecular function (lipid binding) and to localize in extracellular region. It is a salivary protein of unknown function.
References
  • Lamesch P, et al. (2007) hORFeome v3.1: a resource of human open reading frames representing over 10,000 human genes. Genomics. 89(3):307-15.
  • Vargas PA, et al. (2008) Expression of PLUNC family members in benign and malignant salivary gland tumours. Oral Dis. 14(7):613-9.
  • Bingle L, et al. (2009) Characterisation and expression of SPLUNC2, the human orthologue of rodent parotid secretory protein. Histochem Cell Biol. 132(3):339-49.
  • TOP