Human C12orf53 Gene ORF cDNA clone expression plasmid,N terminal Flag tag

Gene

Species

Human

NCBI Ref Seq

BC035736

RefSeq ORF Size

849bp

Gene Synonym

PANP, C12orf53

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Human PILR alpha associated neural protein Gene ORF cDNA clone expression plasmid,N terminal Flag tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-N-FLAG

Restriction Site

Protein Tag

Flag

Tag Sequence

GATTACAAGGATGACGACGATAAG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

C12orf53 is mainly expressed in adult brain and cerebellum. It also can be detected in fetal brain and virtually no expression in spleen, heart, kidney, liver and dorsal ganglion relative to brain. C12orf53 acts as a ligand for PILRA in neural tissues, where it may be involved in immune regulation. Chromosome 12 encodes over 1,100 genes within 132 million bases. A number of skeletal deformities are linked to chromosome 12 including hypochondrogenesis, achondrogenesis and Kniest dysplasia. Noonan syndrome, which includes heart and facial developmental defects among the primary symptoms, is caused by a mutant form of PTPN11 gene product, SH-PTP2. Chromosome 12 is also home to a homeobox gene cluster which encodes crucial transcription factors for morphogenesis, and the natural killer complex gene cluster encoding C-type lectin proteins which mediate the NK cell response to MHC class I interaction.

References

Strausberg RL, et al. (2002) Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences. Proc Natl Acad Sci. 99(26):16899-903.

Ota T, et al. (2004) Complete sequencing and characterization of 21,243 full-length human cDNAs. Tissue Antigens. Nat Genet. 36(1):40-5.

Kogure A, et al. (2011) PANP is a novel O-glycosylated PILR ligand expressed in neural tissues. Biochem Biophys Res Commun. 405(3):428-33.

Catalog Number:HGA932-NF