Human C12orf53 Gene ORF cDNA clone expression plasmid,C terminal HA tag

Catalog Number:HGA932-CY

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
849bp
Gene Synonym
PANP, C12orf53
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human PILR alpha associated neural protein Gene ORF cDNA clone expression plasmid,C terminal HA tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-HA
Restriction Site
Protein Tag
HA
Tag Sequence
TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
HA Tag Information

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
C12orf53 is mainly expressed in adult brain and cerebellum. It also can be detected in fetal brain and virtually no expression in spleen, heart, kidney, liver and dorsal ganglion relative to brain. C12orf53 acts as a ligand for PILRA in neural tissues, where it may be involved in immune regulation. Chromosome 12 encodes over 1,100 genes within 132 million bases. A number of skeletal deformities are linked to chromosome 12 including hypochondrogenesis, achondrogenesis and Kniest dysplasia. Noonan syndrome, which includes heart and facial developmental defects among the primary symptoms, is caused by a mutant form of PTPN11 gene product, SH-PTP2. Chromosome 12 is also home to a homeobox gene cluster which encodes crucial transcription factors for morphogenesis, and the natural killer complex gene cluster encoding C-type lectin proteins which mediate the NK cell response to MHC class I interaction.
References
  • Strausberg RL, et al. (2002) Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences. Proc Natl Acad Sci. 99(26):16899-903.
  • Ota T, et al. (2004) Complete sequencing and characterization of 21,243 full-length human cDNAs. Tissue Antigens. Nat Genet. 36(1):40-5.
  • Kogure A, et al. (2011) PANP is a novel O-glycosylated PILR ligand expressed in neural tissues. Biochem Biophys Res Commun. 405(3):428-33.
  • TOP