Human BTN2A1 Gene ORF cDNA clone expression plasmid,C terminal OFP tag

Catalog Number:HGA892-CO

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1005bp
Gene Synonym
BTF1, BT2.1, DJ3E1.1, BK14H9.1, BTN2A1
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human butyrophilin, subfamily 2, member A1 Gene ORF cDNA clone expression plasmid,C terminal OFP tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-OFPSpark
Restriction Site
Protein Tag
OFPSpark
Tag Sequence
GATAGCACTGAG……CACCTGTTCCAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
OFPSpark Tag Information

OFPSpark is a red (orange) fluorescent protein (excitation/emission maxima are 549 and 566 nm, respectively) derived from DsRed. Possessing high photostability and pH stability, OFPSpark is more than twice brighter than mOrange2. Fast OFPSpark maturation makes it clearly detectable in mammalian cells as early as within 8 hrs after transfection. OFPSpark can be expressed and detected in a wide range of organisms. Mammalian cells transiently transfected with OFPSpark expression vectors produce bright fluorescence in 8 hrs after transfection. No cytotoxic effects or visible protein aggregation are observed. For its monomer structure, OFPSpark performs well in some fusions and protein labeling applications.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
The MHC-encoded butyrophilin, BTN2A1, is a cell surface glycoprotein related to the extended family of B7 costimulatory molecules. BTN2A1 mRNA was expressed in most human tissues, but protein expression was significantly lower in leukocytes. An Ig-fusion protein of BTN2A1 bound to immature monocyte-derived dendritic cells. Binding diminished upon MoDC maturation and no binding was detected to Langerhans cells. Induction of the counterreceptor was IL-4 dependent and occurred early during dendritic cell differentiation. The interaction required the presence of Ca2+ and was mediated by high-mannose oligosaccharides. These properties matched DC-SIGN, a DC-specific HIV-1 entry receptor. This was confirmed by binding of soluble BTN2A1 to DC-SIGN-transfectants and its inhibition by a specific Ab. DC-SIGN bound to native BTN2A1 expressed on a range of tissues. However, BTN2A1 was not recognized on some normal cells such as HUVECs despite a similar expression level. The BTN2A1 of tumor cells such as HEK293T have more high-mannose moieties in comparison to HUVECs, and those high-mannose moieties are instrumental for binding to DC-SIGN
References
  • Malcherek G, Mayr L, Roda-Navarro P, et al. The B7 homolog butyrophilin BTN2A1 is a novel ligand for DC-SIGN[J]. The Journal of Immunology, 2007, 179(6): 3804-3811.
  • TOP