Human BTN2A1 Gene ORF cDNA clone expression plasmid,C terminal Myc tag

Gene

Species

Human

NCBI Ref Seq

BC016661

RefSeq ORF Size

1005bp

Gene Synonym

BTF1, BT2.1, DJ3E1.1, BK14H9.1, BTN2A1

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Human butyrophilin, subfamily 2, member A1 Gene ORF cDNA clone expression plasmid,C terminal Myc tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-C-Myc

Restriction Site

Protein Tag

Myc

Tag Sequence

GAGCAGAAACTCATCTCAGAAGAGGATCTG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

The MHC-encoded butyrophilin, BTN2A1, is a cell surface glycoprotein related to the extended family of B7 costimulatory molecules. BTN2A1 mRNA was expressed in most human tissues, but protein expression was significantly lower in leukocytes. An Ig-fusion protein of BTN2A1 bound to immature monocyte-derived dendritic cells. Binding diminished upon MoDC maturation and no binding was detected to Langerhans cells. Induction of the counterreceptor was IL-4 dependent and occurred early during dendritic cell differentiation. The interaction required the presence of Ca2+ and was mediated by high-mannose oligosaccharides. These properties matched DC-SIGN, a DC-specific HIV-1 entry receptor. This was confirmed by binding of soluble BTN2A1 to DC-SIGN-transfectants and its inhibition by a specific Ab. DC-SIGN bound to native BTN2A1 expressed on a range of tissues. However, BTN2A1 was not recognized on some normal cells such as HUVECs despite a similar expression level. The BTN2A1 of tumor cells such as HEK293T have more high-mannose moieties in comparison to HUVECs, and those high-mannose moieties are instrumental for binding to DC-SIGN

References

Malcherek G, Mayr L, Roda-Navarro P, et al. The B7 homolog butyrophilin BTN2A1 is a novel ligand for DC-SIGN[J]. The Journal of Immunology, 2007, 179(6): 3804-3811.

Catalog Number:HGA892-CM