Human BRDT Gene ORF cDNA clone expression plasmid,N terminal Myc tag

Gene

Species

Human

NCBI Ref Seq

NM_001726.3

RefSeq ORF Size

2844bp

Gene Synonym

CT9, BRD6, BRDT

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Human bromodomain, testis-specific Gene ORF cDNA clone expression plasmid,N terminal Myc tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-N-Myc

Restriction Site

Protein Tag

Myc

Tag Sequence

GAGCAGAAACTCATCTCAGAAGAGGATCTG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

The BRDT gene and its transcripts (bromodomain testis-specific gene, also referred to as FSRG3 or BRD6) represent potential candidates for studying the role of epigenetic changes for fertility and paternal contribution to the embryo, as they play an important role in the establishment of proper germ cell differentiation. The first bromodomain of the BRDT protein recognises the acetylation marks of histone 4 in order to start chromatin remodelling. In addition, male mice carrying a mutation within the allele of the first bromodomain are subfertile. BRDT transcripts have been demonstrated to be specifically expressed in human and murine testis. In the latter, Brdt mRNA has been observed from pachytene spermatocytes to spermatids. In man, a splicing variant of the BRDT gene (BRDT-NY) was found in embryonic and adult human testis and spermatozoa from fertile men. By contrast, transcripts of this splicing variant could not be detected in testis of some azoospermic men including arrest of spermatogenesis at the level of round spermatids. As spermatozoa are known to contain a variety of transcripts and mRNAs could be delivered from sperm to oocyte, it might be possible that BRDT mRNA influences chromatin compaction during spermiogenesis and/or expression of BRDT during early embryogenesis.

References

Steilmann C, Cavalcanti M C O, Bartkuhn M, et al. The interaction of modified histones with the bromodomain testis-specific (BRDT) gene and its mRNA level in sperm of fertile donors and subfertile men[J]. Reproduction, 2010, 140(3): 435-443.

Catalog Number:HGA868-NM