Human BRDT Gene ORF cDNA clone expression plasmid,C terminal HA tag

Gene

Species

Human

NCBI Ref Seq

NM_001726.3

RefSeq ORF Size

2844bp

Gene Synonym

CT9, BRD6, BRDT

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Human bromodomain, testis-specific Gene ORF cDNA clone expression plasmid,C terminal HA tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-C-HA

Restriction Site

Protein Tag

HA

Tag Sequence

TATCCTTACGACGTGCCTGACTACGCC

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

HA Tag Information

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

The BRDT gene and its transcripts (bromodomain testis-specific gene, also referred to as FSRG3 or BRD6) represent potential candidates for studying the role of epigenetic changes for fertility and paternal contribution to the embryo, as they play an important role in the establishment of proper germ cell differentiation. The first bromodomain of the BRDT protein recognises the acetylation marks of histone 4 in order to start chromatin remodelling. In addition, male mice carrying a mutation within the allele of the first bromodomain are subfertile. BRDT transcripts have been demonstrated to be specifically expressed in human and murine testis. In the latter, Brdt mRNA has been observed from pachytene spermatocytes to spermatids. In man, a splicing variant of the BRDT gene (BRDT-NY) was found in embryonic and adult human testis and spermatozoa from fertile men. By contrast, transcripts of this splicing variant could not be detected in testis of some azoospermic men including arrest of spermatogenesis at the level of round spermatids. As spermatozoa are known to contain a variety of transcripts and mRNAs could be delivered from sperm to oocyte, it might be possible that BRDT mRNA influences chromatin compaction during spermiogenesis and/or expression of BRDT during early embryogenesis.

References

Steilmann C, Cavalcanti M C O, Bartkuhn M, et al. The interaction of modified histones with the bromodomain testis-specific (BRDT) gene and its mRNA level in sperm of fertile donors and subfertile men[J]. Reproduction, 2010, 140(3): 435-443.

Catalog Number:HGA868-CY