Human BLVRB Gene ORF cDNA clone expression plasmid,N terminal Flag tag

Gene

Species

Human

NCBI Ref Seq

NM_000713.2

RefSeq ORF Size

621bp

Gene Synonym

FLR, BVRB, SDR43U1, MGC117413, BLVRB

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Human biliverdin reductase B (flavin reductase (NADPH)) Gene ORF cDNA clone expression plasmid,N terminal Flag tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-N-FLAG

Restriction Site

Protein Tag

Flag

Tag Sequence

GATTACAAGGATGACGACGATAAG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Biliverdin reductase (hBVR) is a serine/threonine kinase that catalyzes reduction of the heme oxygenase (HO) activity product, biliverdin, to bilirubin. BVR consists of an N-terminal dinucleotide-binding domain (Rossmann-fold) and a C-terminal domain that contains a six-stranded β-sheet that is flanked on one face by several α-helices. The C-terminal and N-terminal domains interact extensively, forming the active site cleft at their interface. Biliverdin reductase (BVR) catalyzes the last step in heme degradation by reducing the γ-methene bridge of the open tetrapyrrole, biliverdin IXα, to bilirubin with the concomitant oxidation of a β-nicotinamide adenine dinucleotide (NADH) or β-nicotinamide adenine dinucleotide phosphate (NADPH) cofactor. It is now recognized that human BVR (hBVR) is a dual-specificity kinase (Ser / Thr and Tyr) upstream activator of the insulin/insulin growth factor-1 (IGF-1) and mitogen-activated protein kinase (MAPK) signaling pathways. Human BVR (hBVR) is essential for MAPK-extracellular signal-regulated kinase (ERK)1/2 (MEK)-eukaryotic-like protein kinase (Elk) signaling and has been identified as the cytoplasm-nuclear heme transporter of ERK1/2 and hematin, the key components of stress-responsive gene expression.

References

Kapitulnik J, et al. (2009) Pleiotropic functions of biliverdin reductase: cellular signaling and generation of cytoprotective and cytotoxic bilirubin. Trends in Pharmacological Sciences. 30(3): 129-37.

Ahmad Z, et al. (2002) Human Biliverdin Reductase Is a Leucine Zipper-like DNA-binding Protein and Functions in Transcriptional Activation of Heme Oxygenase-1 by Oxidative Stress. The Journal of Biological Chemistry. 277: 9226-32.

Whitby FG, et al. (2002) Crystal Structure of a Biliverdin IX Reductase Enzyme-Cofactor Complex. Journal of Molecular Biology. 319(5): 1199-210.

Catalog Number:HGA826-NF