Human BLOC1S2/BLOS2 Gene ORF cDNA clone expression plasmid,C terminal HA tag

Gene

Species

Human

NCBI Ref Seq

BC020494

RefSeq ORF Size

300bp

Gene Synonym

BLOS2, RP11-316M21.4

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Human biogenesis of lysosomal organelles complex-1, subunit 2 Gene ORF cDNA clone expression plasmid,C terminal HA tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-C-HA

Restriction Site

Protein Tag

HA

Tag Sequence

TATCCTTACGACGTGCCTGACTACGCC

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

HA Tag Information

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

BLOC1S2, also known as BLOS2, belongs to the BLOC1S2 family. It is a component of BLOC-1 complex. The BLOC-1 complex is composed of BLOC1S1, BLOC1S2, BLOC1S3, DTNBP1, MUTED, PLDN, CNO/cappuccino and SNAPIN. The BLOC-1 complex is required for normal biogenesis of lysosome-related organelles, such as platelet dense granules and melanosomes. BLOC1S2 interacts directly with BLOC1S1, BLOC1S3, MUTED, CNO/cappuccino and SNAPIN. It may play a role in cell proliferation. It also plays a role in intracellular vesicle trafficking. Functionally, BLOC1S2 gene has been proposed to participate in processes (melanosome organization, microtubule nucleation, platelet dense granule organization, positive regulation of cell proliferation, positive regulation of transcription, regulation of apoptosis, positive regulation of transcription from RNA polymerase II promoter).

References

Sowa ME, et al. (2009) Defining the human deubiquitinating enzyme interaction landscape. Cell. 138(2):389-403.

Gdynia G, et al. (2008) BLOC1S2 interacts with the HIPPI protein and sensitizes NCH89 glioblastoma cells to apoptosis. Apoptosis. 13(3):437-47.

Starcevic M, et al. (2004) Identification of snapin and three novel proteins (BLOS1, BLOS2, and BLOS3/reduced pigmentation) as subunits of biogenesis of lysosome-related organelles complex-1 (BLOC-1). J Biol Chem. 279(27):28393-401.

Catalog Number:HGA824-CY