Human BLOC1S2/BLOS2 Gene ORF cDNA clone expression plasmid,C terminal Myc tag

Catalog Number:HGA824-CM

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
300bp
Gene Synonym
BLOS2, RP11-316M21.4
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human biogenesis of lysosomal organelles complex-1, subunit 2 Gene ORF cDNA clone expression plasmid,C terminal Myc tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-Myc
Restriction Site
Protein Tag
Myc
Tag Sequence
GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
BLOC1S2, also known as BLOS2, belongs to the BLOC1S2 family. It is a component of BLOC-1 complex. The BLOC-1 complex is composed of BLOC1S1, BLOC1S2, BLOC1S3, DTNBP1, MUTED, PLDN, CNO/cappuccino and SNAPIN. The BLOC-1 complex is required for normal biogenesis of lysosome-related organelles, such as platelet dense granules and melanosomes. BLOC1S2 interacts directly with BLOC1S1, BLOC1S3, MUTED, CNO/cappuccino and SNAPIN. It may play a role in cell proliferation. It also plays a role in intracellular vesicle trafficking. Functionally, BLOC1S2 gene has been proposed to participate in processes (melanosome organization, microtubule nucleation, platelet dense granule organization, positive regulation of cell proliferation, positive regulation of transcription, regulation of apoptosis, positive regulation of transcription from RNA polymerase II promoter).
References
  • Sowa ME, et al. (2009) Defining the human deubiquitinating enzyme interaction landscape. Cell. 138(2):389-403.
  • Gdynia G, et al. (2008) BLOC1S2 interacts with the HIPPI protein and sensitizes NCH89 glioblastoma cells to apoptosis. Apoptosis. 13(3):437-47.
  • Starcevic M, et al. (2004) Identification of snapin and three novel proteins (BLOS1, BLOS2, and BLOS3/reduced pigmentation) as subunits of biogenesis of lysosome-related organelles complex-1 (BLOC-1). J Biol Chem. 279(27):28393-401.
  • TOP